<?xml version="1.0" encoding="UTF-8"?>
<!DOCTYPE article PUBLIC "-//NLM//DTD JATS (Z39.96) Journal Publishing DTD v1.3 20210610//EN" "JATS-journalpublishing1-3-mathml3.dtd">
<article xmlns:mml="http://www.w3.org/1998/Math/MathML" xmlns:xlink="http://www.w3.org/1999/xlink" xmlns:ali="http://www.niso.org/schemas/ali/1.0/" xmlns:xsi="http://www.w3.org/2001/XMLSchema-instance" article-type="research-article" dtd-version="1.3" xml:lang="EN">
<front>
<journal-meta>
<journal-id journal-id-type="publisher-id">Acta Biochim. Pol.</journal-id>
<journal-title-group>
<journal-title>Acta Biochimica Polonica</journal-title>
<abbrev-journal-title abbrev-type="pubmed">Acta Biochim. Pol.</abbrev-journal-title>
</journal-title-group>
<issn pub-type="epub">1734-154X</issn>
<publisher>
<publisher-name>Frontiers Media S.A.</publisher-name>
</publisher>
</journal-meta>
<article-meta>
<article-id pub-id-type="publisher-id">16199</article-id>
<article-id pub-id-type="doi">10.3389/abp.2026.16199</article-id>
<article-version article-version-type="Version of Record" vocab="NISO-RP-8-2008"/>
<article-categories>
<subj-group subj-group-type="heading">
<subject>Original Research</subject>
</subj-group>
</article-categories>
<title-group>
<article-title>Differential <italic>in vitro</italic> and <italic>in vivo</italic> responses of <italic>Akkermansia muciniphila</italic> to <italic>Odontosoria biflora</italic> (Kaulf.) C.Chr. [<italic>Lindsaeaceae</italic>] hexane extract in diet- and alloxan-induced BALB/c mice</article-title>
<alt-title alt-title-type="left-running-head">Hamel Darbandi and Dalmacio</alt-title>
<alt-title alt-title-type="right-running-head">
<ext-link ext-link-type="uri" xlink:href="https://doi.org/10.3389/abp.2026.16199">10.3389/abp.2026.16199</ext-link>
</alt-title>
</title-group>
<contrib-group>
<contrib contrib-type="author" corresp="yes">
<name>
<surname>Hamel Darbandi</surname>
<given-names>Marvie</given-names>
</name>
<xref ref-type="aff" rid="aff1">
<sup>1</sup>
</xref>
<xref ref-type="aff" rid="aff2">
<sup>2</sup>
</xref>
<xref ref-type="corresp" rid="c001">&#x2a;</xref>
<uri xlink:href="https://loop.frontiersin.org/people/3340306"/>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Dalmacio</surname>
<given-names>Leslie Michelle M.</given-names>
</name>
<xref ref-type="aff" rid="aff1">
<sup>1</sup>
</xref>
</contrib>
</contrib-group>
<aff id="aff1">
<label>1</label>
<institution>Department of Biochemistry and Molecular Biology, College of Medicine, University of the Philippines Manila</institution>, <city>Metro Manila</city>, <country country="PH">Philippines</country>
</aff>
<aff id="aff2">
<label>2</label>
<institution>Department of Biochemistry, Nutrition and Molecular Biology, School of Medicine, Bohol Island State University</institution>, <city>Tagbilaran</city>, <state>Bohol</state>, <country country="PH">Philippines</country>
</aff>
<author-notes>
<corresp id="c001">
<label>&#x2a;</label>Correspondence: Marvie Hamel Darbandi, <email xlink:href="mailto:mphameldarbandi@up.edu.ph">mphameldarbandi@up.edu.ph</email>
</corresp>
</author-notes>
<pub-date publication-format="electronic" date-type="pub" iso-8601-date="2026-02-24">
<day>24</day>
<month>02</month>
<year>2026</year>
</pub-date>
<pub-date publication-format="electronic" date-type="collection">
<year>2026</year>
</pub-date>
<volume>73</volume>
<elocation-id>16199</elocation-id>
<history>
<date date-type="received">
<day>06</day>
<month>01</month>
<year>2026</year>
</date>
<date date-type="rev-recd">
<day>07</day>
<month>02</month>
<year>2026</year>
</date>
<date date-type="accepted">
<day>10</day>
<month>02</month>
<year>2026</year>
</date>
</history>
<permissions>
<copyright-statement>Copyright &#xa9; 2026 Hamel Darbandi and Dalmacio.</copyright-statement>
<copyright-year>2026</copyright-year>
<copyright-holder>Hamel Darbandi and Dalmacio</copyright-holder>
<license>
<ali:license_ref start_date="2026-02-24">https://creativecommons.org/licenses/by/4.0/</ali:license_ref>
<license-p>This is an open-access article distributed under the terms of the <ext-link ext-link-type="uri" xlink:href="https://creativecommons.org/licenses/by/4.0/">Creative Commons Attribution License (CC BY)</ext-link>. The use, distribution or reproduction in other forums is permitted, provided the original author(s) and the copyright owner(s) are credited and that the original publication in this journal is cited, in accordance with accepted academic practice. No use, distribution or reproduction is permitted which does not comply with these terms.</license-p>
</license>
</permissions>
<abstract>
<p>
<italic>Akkermansia muciniphila</italic> is a mucin-degrading gut bacterium linked to metabolic health, yet culture-based growth stimulation may not translate to sustained enrichment <italic>in vivo</italic>. <italic>Odontosoria biflora</italic> (&#x201c;tubho&#x201d;) is traditionally consumed in the Philippines as a herbal tea, but its extract-level activity toward <italic>A. muciniphila</italic> remains poorly characterized. <italic>O. biflora</italic> was sequentially extracted (hexane, ethyl acetate, methanol, aqueous) and screened for growth-supporting activity toward <italic>A. muciniphila</italic> in modified BHI under anaerobic conditions. The most active fraction (hexane; OBE HEX) was evaluated for acute oral tolerability in BALB/c mice according to OECD Tesy No. 423 (up to 2000&#xa0;mg/kg) and subsequently assessed in a high-fat/high-sugar diet plus alloxan-induced diabetic model. Fecal <italic>A. muciniphila-</italic>specific qPCR signal was monitored at weeks 0, 1, 2, and 4 using a modified 2<sup>&#x2212;</sup>&#x394;&#x394;Ct approach with external ATCC genomic DNA as a reference. OBE-HEX produced the strongest <italic>in vitro</italic> growth-supporting effect (56.43% at 250&#xa0;mg/L, p &#x3c; 0.05; 85.62% at 500&#xa0;mg/L, p &#x3c; 0.001) and showed no observable toxicity <italic>in vivo</italic>. In contrast, <italic>in vivo</italic> analysis revealed only transient changes in fecal <italic>A. muciniphila</italic> detection following OBE-HEX administration, whereas sustained elevation was observed only in metformin-treated mice. Untargeted UPLC-ESI-QTOF-MS analysis of OBE-HEX yielded putative identification of 2-O-rhamnosylvitexin and 7-methoxy-9,10-dihydrophenanthrene-2,5-diol. Overall, these findings demonstrate that while <italic>O. biflora</italic> hexane extract exhibits direct growth-supporting activity toward <italic>A. muciniphila in vitro</italic> and is orally tolerable, such effects do not translate into sustained <italic>in vivo</italic> enrichment under diabetic conditions, underscoring the limitations of extrapolating culture-based microbiota screening results to host-associated systems.</p>
</abstract>
<kwd-group>
<kwd>
<italic>Akkermansia muiciniphila</italic>
</kwd>
<kwd>BALB/c mice</kwd>
<kwd>diabetes mellitus</kwd>
<kwd>fecal qPCR</kwd>
<kwd>
<italic>in vitro</italic> and <italic>in vivo</italic> comparison</kwd>
</kwd-group>
<funding-group>
<funding-statement>The author(s) declared that financial support was not received for this work and/or its publication.</funding-statement>
</funding-group>
<counts>
<fig-count count="4"/>
<table-count count="2"/>
<equation-count count="5"/>
<ref-count count="47"/>
<page-count count="13"/>
</counts>
</article-meta>
</front>
<body>
<sec sec-type="intro" id="s1">
<title>Introduction</title>
<p>Type 2 diabetes mellitus (T2DM) is the most common form of diabetes and is characterized by chronic hyperglycemia driven by insulin resistance and progressive beta cell dysfunction (<xref ref-type="bibr" rid="B3">American Diabetes Association Professional Practice Committee, 2024</xref>; <xref ref-type="bibr" rid="B23">Galicia Garcia et al., 2020</xref>). In the Philippines, cohort evidence indicates a sustained burden of T2DM among adults (<xref ref-type="bibr" rid="B41">Soria et al., 2009</xref>). Beyond its clinical relevance, T2DM is frequently employed as an experimental model of metabolic and inflammatory stress that disrupts host&#x2013;microbe interactions and intestinal homeostasis (<xref ref-type="bibr" rid="B13">Chong et al., 2025</xref>; <xref ref-type="bibr" rid="B21">Fliegerov&#xe1; et al., 2025</xref>).</p>
<p>The gut microbiota is increasingly viewed as a mechanistic interface linking diet, immunity, and host metabolism. Gut dysbiosis and functional microbial shifts are associated with impaired glucose regulation, compromised intestinal barrier integrity, and metabolic endotoxemia, processes that can amplify low grade inflammation and insulin resistance in T2DM (<xref ref-type="bibr" rid="B24">Gurung et al., 2020</xref>; <xref ref-type="bibr" rid="B14">Crudele et al., 2023</xref>; <xref ref-type="bibr" rid="B4">An et al., 2022</xref>). Accordingly, diet-derived microbiota interacting factors have been investigated as tools to probe species-specific microbial responses under perturbed metabolic conditions rather than solely as therapeutic interventions (<xref ref-type="bibr" rid="B38">Sahhaf Ebrahimi et al., 2019</xref>; <xref ref-type="bibr" rid="B50">Wang et al., 2024</xref>).</p>
<p>Among gut-associated bacteria, <italic>Akkermansia muciniphila</italic> has gained particular attention as a novel probiotic candidate; its abundance is consistently linked to improved glucose homeostasis, making it a key microbial marker for metabolic health in T2DM (<xref ref-type="bibr" rid="B49">Rodrigues et al., 2022</xref>; <xref ref-type="bibr" rid="B19">Dianti et al., 2022</xref>). Clinical and experimental studies report associations between <italic>A. muciniphila</italic> abundance and improved insulin sensitivity in T2DM, including evidence from pasteurized <italic>A. muciniphila</italic> supplementation trials (<xref ref-type="bibr" rid="B18">Depommier et al., 2019</xref>). Importantly, <italic>A. muciniphila</italic> was selected in the present study as a biologically informative taxon to assess species-specific microbial responses, rather than as a representative of probiotic bacteria as a whole.</p>
<p>Plant based foods and medicinal plants provide diverse compounds that may modulate gut bacteria. Beyond classical prebiotic fibers, polyphenols and other secondary metabolites can influence bacteria directly or indirectly through altered mucin metabolism, microbial cross feeding, redox balance, and intestinal barrier function (<xref ref-type="bibr" rid="B35">Rodr&#xed;guez-Daza and de Vos, 2022</xref>; <xref ref-type="bibr" rid="B8">Barik et al., 2024</xref>; <xref ref-type="bibr" rid="B47">Xu et al., 2019</xref>). However, culture-based growth stimulation does not guarantee enrichment <italic>in vivo</italic>, where host physiology and microbial competition constrain ecological outcomes.</p>
<p>
<italic>Odontosoria biflora</italic>, commonly known as &#x201c;tubho&#x201d; fern, is traditionally consumed as an herbal tea by the Ivatan people of the Philippines and is culturally regarded to have antioxidant property, medicinal benefits and longevity (<xref ref-type="bibr" rid="B40">Slow Food Foundation for Biodiversity, 2018</xref>; <xref ref-type="bibr" rid="B17">Department of Science and Technology &#x2013; Provincial Science and Technology Office Region 2, 2024</xref>). To date, this is the first experimental investigation of <italic>O. biflora</italic> potential bioactivity and interaction with gut-associated bacteria. While the whole plant contains diverse nutritional components, including fiber and carbohydrates, the present study focuses on solvent extracts to evaluate extract-level bioactivity rather than whole plant dietary effects. Related <italic>Odontosoria</italic> species are rich in bioactive phenolics, tannins, and flavonoids known to inhibit carbohydrate-hydrolyzing enzymes, a mechanism relevant to glycemic regulation (<xref ref-type="bibr" rid="B27">Johnson et al., 2020</xref>; <xref ref-type="bibr" rid="B36">Rohn et al., 2002</xref>). The presence of flavonoid derivatives like quercetin glycosides provides a biochemical basis for exploring potential interactions with <italic>A</italic>. <italic>muciniphila</italic>, a mucin-associated bacterium known to respond to polyphenolic environments (<xref ref-type="bibr" rid="B42">Tang et al., 2024</xref>).</p>
<p>In this study, <italic>A. muciniphila</italic> was selected as a biologically informative taxon to evaluate microbiota-related responses under controlled <italic>in vitro</italic> and <italic>in vivo</italic> conditions. Sequential extracts of <italic>O. biflora</italic> were screened for growth-supporting activity toward <italic>A. muciniphila in vitro</italic>, and the most active fraction was subsequently evaluated for oral tolerability following OECD guidelines (<xref ref-type="bibr" rid="B32">OECD Test No. 423, 2002</xref>). Furthermore, <italic>in vivo</italic> effects on fecal <italic>A. muciniphila</italic>-specific qPCR signal were assessed using a high-fat/high-sugar diet combined with an alloxan-induced diabetes model, which integrates insulin resistance with beta-cell injury (<xref ref-type="bibr" rid="B26">Ighodaro et al., 2017</xref>; <xref ref-type="bibr" rid="B1">Al-Awar et al., 2016</xref>; <xref ref-type="bibr" rid="B9">Binh et al., 2021</xref>).</p>
</sec>
<sec sec-type="materials|methods" id="s2">
<title>Materials and methods</title>
<sec id="s2-1">
<title>Sample collection and preparation of <italic>O. biflora</italic> extraction</title>
<p>Five hundred grams of <italic>O. biflora</italic> (Kaulf.) C. Chr. [Lindsaeaceae] leaves and stem were collected from Chavakan, Sinakan Sabtang, Batanes Island, Philippines were harvested, sectioned, thoroughly rinsed with distilled aqueous solution, and allowed to air-dry for 48&#xa0;h. Botanical authentication of the plant material was conducted at the Herbarium of the Institute of Biology, University of the Philippines Diliman. The dried samples were subsequently cut into uniform strips, immersed, and stored in airtight containers prior to extraction. Sequential solvent extraction was performed using solvents of increasing polarity, namely hexane, ethyl acetate, methanol, and an aqueous solvent (<xref ref-type="bibr" rid="B25">Hamel Darbandi et al., 2026</xref>). The collected extracts from one solvent were pooled and subjected to a rotary evaporator (B&#xfc;chi, Switzerland) until completely dry.</p>
</sec>
<sec id="s2-2">
<title>Determination of the effect of the different extracts of <italic>O. biflora</italic> on the growth of <italic>A. muciniphila in vitro</italic>
</title>
<p>To assess the growth response of <italic>A. muciniphila, Odontoria biflora</italic> extracts (OBE) were prepared through sequential solvent extraction using hexane, ethyl acetate, methonal and aqueous. The most active extract was then utilized in the subsequent experiments. Briefy, the <italic>A. muciniphila</italic> type strain Muc<sup>T</sup> (&#x3d; ATCC BAA-835<sup>T</sup> &#x3d; CIP 107961<sup>T</sup>), obtained from the Japan Collection of Microorganisms (JCM) at the RIKEN BioResource Research Center, was cultured anaerobically in Brain Heart Infusion (BHI) medium, following the protocol of <xref ref-type="bibr" rid="B30">Lou et al. (2021)</xref> with modifications. To evaluate the growth-promoting activity of OBE, Brain Heart Infusion (BHI) broth was supplemented with OBE at final concentrations of 250&#xa0;mg/L and 500&#xa0;mg/L, along with 2&#xa0;g/L glucose as an additional carbon source. These concentrations were selected based on established extract supplementation ranges reported in microbial growth assays, including <xref ref-type="bibr" rid="B46">Xia et al. (2021)</xref>, who supplemented cultures with bioactive plant compounds at comparable upper limits (150&#x2013;500&#xa0;mg/L), demonstrating the feasibility of high-dose phytochemical testing in <italic>A. muciniphila</italic> growth. Cultures were incubated anaerobically at 37&#xa0;&#xb0;C for 24&#xa0;h, consistent with the short-term growth and metabolic response assays reported for <italic>A. muciniphila</italic> (<xref ref-type="bibr" rid="B46">Xia et al., 2021</xref>; <xref ref-type="bibr" rid="B28">Liu et al., 2024</xref>). Anaerobic conditions were generated using the candle-jar method of <xref ref-type="bibr" rid="B37">Saha et al. (2016)</xref>, which provides a cost-efficient low-oxygen environment suitable for anaerobe cultivation.</p>
<p>The relative growth yield of <italic>A. muciniphila</italic> was determined by measuring optical density at 620&#xa0;nm and applying the modified calculation of <xref ref-type="bibr" rid="B46">Xia et al. (2021)</xref>, where A represents the OD<sub>620</sub> of cultures grown in BHI with glucose and OBE, and B represents the OD<sub>620</sub> change of cultures grown with BHI and OBE alone. Relative growth was computed using the formula:<disp-formula id="equ1">
<mml:math id="m1">
<mml:mrow>
<mml:mtext>Relative&#x2009;&#x2009;growth</mml:mtext>
<mml:mo>&#x3d;</mml:mo>
<mml:mfrac>
<mml:mrow>
<mml:mi mathvariant="normal">A</mml:mi>
<mml:mo>&#x2212;</mml:mo>
<mml:mi mathvariant="normal">B</mml:mi>
</mml:mrow>
<mml:mi mathvariant="normal">B</mml:mi>
</mml:mfrac>
<mml:mi mathvariant="normal">&#x00D7;</mml:mi>
<mml:mtext>&#x2009;</mml:mtext>
<mml:mn>100</mml:mn>
<mml:mo>%</mml:mo>
</mml:mrow>
</mml:math>
</disp-formula>
</p>
<p>The experiment was conducted in three independent trials, each performed in triplicate.</p>
</sec>
<sec id="s2-3">
<title>Determination of the acute oral toxicity assay</title>
<p>The study design followed the general principles of internationally accepted acute oral toxicity guidelines for rodents, and the results were used to establish the safe dose range for subsequent <italic>in vivo</italic> assays. Acute oral toxicity of <italic>Odontosoria biflora</italic> hexane extract (OBE HEX) was evaluated in male BALB/c mice (6&#x2013;7&#xa0;weeks, 20&#x2013;25&#xa0;g) sourced from IACUC approved and Bureau of Animal Industry (BAI) accredited breeder (Mots Animal House Laboratory and Research, Sta. Rosa city, Laguna). Four mice received single oral doses of 250, 500, 1,000, or 2000&#xa0;mg/kg (1&#xa0;mouse per dose). OBE HEX was formulated in 1 percent dimethyl sulfoxide (DMSO) in normal saline, a vehicle concentration considered safe for murine studies (<xref ref-type="bibr" rid="B43">Tomislav et al., 2011</xref>). Clinical signs, including changes in skin and fur, eyes and mucous membranes, respiration, circulation, autonomic and central nervous function, behavioral activity, and specific indicators such as gastrointestinal discomfort, diarrheal spots, tremors, convulsions, lethargy, or coma, were recorded twice on Day 1 and once daily thereafter for 14 days in accordance with internationally accepted acute oral toxicity guidelines for rodents (Organization for Economic Co-operation and Development [OECD], 2002). Each mouse was classified as A (death), B (evident toxicity), or C (no toxicity) (<xref ref-type="bibr" rid="B32">OECD Test No. 423, 2002</xref>).</p>
</sec>
<sec id="s2-4">
<title>Animal model</title>
<p>Thirty males, 6&#x2013;7-week-old BALB/c mice (25 &#xb1; 5&#xa0;g) were sourced from Bureau of Animal Industry (BAI) accredited breeder, and provided with a standard diet and free access to water. The mice were maintained at 20&#xa0;&#xb0;C&#x2013;22&#xa0;&#xb0;C, with five mice per cage and housed in the Multidisciplinary Laboratory, Paz Mendoza Building, University of the Philippines Manila. The mice (n &#x3d; 30) were divided into six groups (<xref ref-type="fig" rid="F1">Figure 1</xref>): 1) N, normal mice receiving 0.2&#xa0;mL normal saline; 2) N &#x2b; OBE, normal mice administered with 500&#xa0;mg/kg OBE; 3) DM, untreated diabetic mice; 4) DM &#x2b; MET, diabetic mice treated with 500&#xa0;mg/kg metformin; 5) DM &#x2b; LOBE, diabetic mice treated with 250&#xa0;mg/kg OBE (low dose); and 6) DM &#x2b; HOBE, diabetic mice treated with 500&#xa0;mg/kg (high dose). The doses of OBE and metformin were selected based on established dosing ranges for plant-derived extracts in BALB/c mouse models. Metformin was administered at 500&#xa0;mg/kg as a reference treatment (<xref ref-type="bibr" rid="B6">Aslam et al., 2017</xref>) while OBE was given at 250&#xa0;mg/kg and 500&#xa0;mg/kg, doses commonly used in BALB/c studies evaluating biological responses to whole-plant extracts (<xref ref-type="bibr" rid="B34">Qin et al., 2022</xref>; <xref ref-type="bibr" rid="B2">Ali et al., 2021</xref>). Dose selection was further supported by acute oral toxicity assay conducted in the present study.</p>
<fig id="F1" position="float">
<label>FIGURE 1</label>
<caption>
<p>Schematic diagram of animal set-up model.</p>
</caption>
<graphic xlink:href="abp-73-16199-g001.tif">
<alt-text content-type="machine-generated">Experimental design diagram showing six groups of male Balb/c mice divided by diet and treatment, including standard chow or high fat, high sugar diet, and therapies with saline, metformin, or varying doses of Odontosoria biflora extract. The timeline outlines a seven-day acclimatization, diabetes induction with alloxan, fasting, fasting blood glucose testing, and a four-week treatment period with periodic fecal collection and sacrifice at the end.</alt-text>
</graphic>
</fig>
<p>After a 1-week acclimatization period, the N and N &#x2b; OBE groups were fed with standard chow diet (Altromin 1324, Altromin GmbH, Lage, Germany), while all DM groups were fed a high-fat, high-sugar diet (Research Diets D12451, New Brunswick, NJ, USA), containing 45% kcal% fat, 20% kcal% protein, and 35% kcal% carbohydrates for 8 weeks. On day 5 of week 4, all DM groups were injected intraperitoneally with a single dose of 200&#xa0;mg/kg alloxan (Sigma Aldrich, UK) to induce diabetes (<xref ref-type="bibr" rid="B6">Aslam et al., 2017</xref>).</p>
<p>Alloxan has long been used as a standard procedure to induce hyperglycemia in experimental diabetes models across various species (<xref ref-type="bibr" rid="B26">Ighodaro et al., 2017</xref>). While alloxan typically produces an insulin-deficient phenotype, pairing it with a high-fat/high-glucose diet can yield a type-2-like state characterized by insulin resistance plus &#x3b2;-cell dysfunction, as demonstrated in murine models for type 2 diabetes mellitus (<xref ref-type="bibr" rid="B9">Binh et al., 2021</xref>; <xref ref-type="bibr" rid="B10">Bondar et al., 2025</xref>). After 12&#xa0;h of fasting, fasting blood glucose (FBG) was measured using Lifescan ONETOUCH UltraPlus glucometer (Johnson &#x26; Johnson, New Jersey, US), the glucometer measures glucose in a whole blood sample, but it is plasma-calibrated so that the results are displayed as plasma-equivalent values. This is done to allow for easier comparison with laboratory test results, which are typically reported in plasma-equivalent units. Diabetic mice are described as having a blood glucose level of more than 200&#xa0;mg/dL, while non-diabetic mice are described as having a blood glucose level lower than 200&#xa0;mg/dL (<xref ref-type="bibr" rid="B6">Aslam et al., 2017</xref>). The most active extract of OBE obtained from <italic>in vitro</italic> studies were used as treatment and administered via oral gavage every other day for 4&#xa0;weeks of the treatment period. The protocols were submitted and approved by the Institutional Animal Care and Use Committee (IACUC Protocol No. 2024-003) of University of the Philippines Manila and performed completely in line with the guidelines of the Animal Ethics Committee. Mice were sacrificed on the 3rd day after week 4 of the treatment period through cervical dislocation as a euthanasia procedure approved by the UP Manila IACUC.</p>
</sec>
<sec id="s2-5">
<title>Determination of the effects of OBE in <italic>Akkermansia muciniphila</italic>
</title>
<sec id="s2-5-1">
<title>Fecal sample collection</title>
<p>Fecal samples from each mouse were collected at weeks 0, 1, 2, and 4 of the treatment period. Since gut microflora from the distal gut are shed from feces, fecal samples were collected directly from the mice or from the sterile beddings. Beddings were changed with new autoclaved beddings before collection and fecal samples collected from each mouse were stored in individual sterile 1.5&#xa0;mL microcentrifuge tubes, accordingly labeled, at 4&#xa0;&#xb0;C.</p>
</sec>
<sec id="s2-5-2">
<title>Fecal DNA extraction and bacterial DNA quality and quantity assessment</title>
<p>Microbial DNA was extracted from 200&#xa0;mg fecal samples of each mouse using the E. Z.N.A.&#xae; Stool DNA Kit (Omega Bio-Tek, Norcross, GA, United States), following the manufacturer&#x2019;s protocol. A 200&#xa0;mg of the fecal samples for each mouse and time point was added to the dry bead tube containing garnet beads. The mechanical collisions between the beads lysed the cells combined with chemical lysis by SLX-Mlus Buffer, ensuring efficient release of microbial DNA from fecal samples. To remove common substances in fecal samples that may interfere with the downstream analyses, the kit has a cationic High Throughput (cHTR) Reagent and pre-lysis (P2) Buffer. Total genomic DNA was captured on a silica spin column and was washed and eluted to a new collection tube. The bacterial genomic DNA was prepared for downstream applications including quantitative PCR and next-generation sequencing analysis. The extracted DNA concentration and purity were measured using the Thermo ScientificTM NanoDropTM Spectrophotometer 2000 (Wilmington, USA). Solution C6 or the elution buffer from the E.Z.N.A. Stool DNA Kit was used as blank. The dsDNA concentration was expressed in ng/&#xb5;L and computed by multiplying the A260 reading with the dilution factor, and using the relationship that an A260 of 1.0 &#x3d; 50&#xa0;&#x3bc;g/mL pure dsDNA. Purity was measured by finding the ratio of the absorbance readings at 260/280 and 260/230.</p>
</sec>
<sec id="s2-5-3">
<title>Quantification of <italic>A. muciniphila</italic>
</title>
<p>Relative quantification of <italic>A. muciniphila</italic> was done using GoTaq&#xae; qPCR Master Mix (Promega) with primer sequences detailed on <xref ref-type="table" rid="T1">Table 1</xref> and sourced from Genomics Laboratory. The mastermix contained carboxy-X-rhodamine (BRYT) Green&#xae; Dye as the fluorescent dye and Hot Start polymerase together with the reaction buffer, MgCl<sub>2</sub>, dNTPs and stabilizers. Each sample was done in triplicate and a &#x201c;no-template&#x201d; negative control was included. The qPCR run consists of enzyme activation at 95&#xa0;&#xb0;C for 2&#xa0;min, followed by 40 cycles of denaturation at 95&#xa0;&#xb0;C for 15s, annealing for 60s at 60&#xa0;&#xb0;C and extension at 72&#xa0;&#xb0;C for 60s, and a final extension for 5&#xa0;min at 72&#xa0;&#xb0;C. A melt curve was generated afterwards to confirm the specificity of the reaction. Amplification and melting curves were analyzed using the Quantitation&#x2013;Comparative Ct (&#x394;&#x394;Ct) and Tm analysis module of the CFX Opus 96 Real-Time PCR System (Bio-Rad Laboratories, Hercules, CA, USA). Relative quantification was performed using a modified 2<sup>&#x2212;&#x394;&#x394;</sup>Ct approach in which genomic DNA from <italic>A. muciniphila</italic> ATCC strain served as the external reference template, and the Normal group acted as the biological calibrator. Validation of this approach was supported by single-peak melt curves, consistent Ct values for the ATCC reference across runs, and acceptable reproducibility among technical triplicates, indicating specific amplification and matched reaction efficiencies between reference and sample DNA. This modified comparative Ct approach is consistent with bacterial qPCR workflows that quantify species-specific targets relative to a reference template and compute fold-changes using the 2<sup>&#x2212;</sup>&#x394;&#x394;Ct method, as demonstrated by <xref ref-type="bibr" rid="B39">Sezgin et al. (2022)</xref>. Relative abundance was calculated according to <xref ref-type="bibr" rid="B29">Livak and Schmittgen (2001)</xref> using the equation:<disp-formula id="equ2">
<mml:math id="m2">
<mml:mrow>
<mml:mtext>Relative&#x2009;&#x2009;expression</mml:mtext>
<mml:mo>&#x3d;</mml:mo>
<mml:msup>
<mml:mn>2</mml:mn>
<mml:mrow>
<mml:mo>&#x2212;</mml:mo>
<mml:mo>&#x394;</mml:mo>
<mml:mo>&#x394;</mml:mo>
<mml:mi>C</mml:mi>
<mml:mi>t</mml:mi>
</mml:mrow>
</mml:msup>
</mml:mrow>
</mml:math>
</disp-formula>
</p>
<table-wrap id="T1" position="float">
<label>TABLE 1</label>
<caption>
<p>
<italic>Akkermansia muciniphila</italic> 16S RNA gene-based primer.</p>
</caption>
<table>
<thead valign="top">
<tr>
<th align="left">Bacterial target</th>
<th align="left">Direction</th>
<th align="left">Primer sequence (5&#x2019;&#x2192;3&#x2032;)</th>
<th align="left">Amplicon size</th>
</tr>
</thead>
<tbody valign="top">
<tr>
<td align="left">
<italic>Akkermansia muciniphila</italic>
</td>
<td align="left">Forward<break/>Reverse</td>
<td align="left">CAGCACGTGAAGGTGGGGAC<break/>CCTTGCGGTTGGCTTCAGAT</td>
<td align="left">329 bp</td>
</tr>
</tbody>
</table>
</table-wrap>
<p>Where:<list list-type="simple">
<list-item>
<p>&#x394; <italic>Ct</italic> &#x3d; <sup>
<italic>Ct</italic>
</sup> target gene (sample) &#x2013; Ct reference gene (<italic>A. muciniphila</italic> ATCC strain)</p>
</list-item>
<list-item>
<p>&#x394; &#x394; <italic>Ct</italic> &#x3d; <sup>&#x394;</sup> <sup>
<italic>Ct</italic>
</sup> target gene (treatment group) &#x2013; <sup>&#x394;</sup> <sup>
<italic>Ct</italic>
</sup> reference gene (normal control group)</p>
</list-item>
</list>
</p>
</sec>
</sec>
<sec id="s2-6">
<title>Determination of the chemical composition of the selected <italic>O. biflora</italic> extract and its proximate analysis</title>
<sec id="s2-6-1">
<title>Metabolite profiling</title>
<p>Sample preparation was done by dissolving 10&#xa0;mg of the extract in 200&#xa0;&#xb5;L of DMSO, followed by the addition of 4.8&#xa0;mL of acetonitrile and then homogenized using a vortex mixer. Subsequently, the solution was filtered through a 0.2-&#xb5;m PTFE syringe filter and transferred into clear LC-MS vials. Acetonitrile served as the blank for analysis, while quercetin was used as standard. Metabolite profiling was performed using high-resolution ultra-performance liquid chromatography coupled with electrospray ionization/quadrupole time-of-flight mass spectrometry (HR-UPLC-ESI-QTOF-MS) at University of the Philippines Los Ba&#xf1;os. Chromatographic separation was done by a reverse-phase Waters ACQUITY HSS C18 column (2.1&#xa0;mm &#xd7; 100&#xa0;mm, 1.8-&#xb5;m particle size). To enhance mass accuracy, the mass analyzers were calibrated using a 0.5-mM sodium formate solution. A lock mass solution containing leucine-enkephalin at a concentration of 200&#xa0;pg/&#x3bc;L in a 50:50 (v/v) acetonitrile&#x2013;water mixture with 0.1% formic acid was continuously infused at 30-s intervals throughout the LC run, with each spray scanned for 1.5&#xa0;s (m/z 556.2771). The mobile phase consisted of (A) ultrapure water with 0.1% formic acid and (B) acetonitrile with 0.1% formic acid. A gradient elution program was employed as follows: 15%&#x2013;40% B (0&#x2013;1.67&#xa0;min), 40%&#x2013;55% B (1.67&#x2013;5.00&#xa0;min), 55%&#x2013;75% B (5.00&#x2013;6.67&#xa0;min), 75%&#x2013;80% B (6.67&#x2013;10.84&#xa0;min), 80%&#x2013;95% B (10.84&#x2013;13.34&#xa0;min), 95%&#x2013;15% B (13.34&#x2013;15.01&#xa0;min), and finally, 15%&#x2013;5% B (15.01&#x2013;18.00&#xa0;min). LC-MS data acquisition was performed using MassLynx 4.2 software, covering a mass range of 50&#x2013;1,500&#xa0;Da. Instrument settings included a cone voltage of 40&#xa0;V, source offset of 80&#xa0;V, capillary voltage of 3.0&#xa0;kV, source temperature of 120&#xa0;&#xb0;C, and desolvation temperature of 450&#xa0;&#xb0;C. Nitrogen was used as the desolvation gas at a flow rate of 600&#xa0;L/h, while argon was employed as the cone gas at 100&#xa0;L/h. The column was maintained at 30&#xa0;&#xb0;C, and the sample storage temperature was set to 15&#xa0;&#xb0;C. Electrospray ionization was performed in positive ionization mode, utilizing the data-independent acquisition method (MSE mode) in continuum format. Collision energy settings included 6&#xa0;eV for low-energy scans and a ramp from 30 to 50&#xa0;eV for high-energy scans. The photodiode array (PDA) detector was configured to scan wavelengths ranging from 190 to 500&#xa0;nm. The sample injection volume was 2&#xa0;&#x3bc;L, with a flow rate of 0.25&#xa0;mL/min. RAW files generated from the analysis were converted to ABF format using the Reifycs ABF Converter. Peak alignment, detection, and identification were processed using MS-DIAL version 4.9 software<xref ref-type="fn" rid="fn1">
<sup>1</sup>
</xref>, with spectral databases from the MS/MS-Pos libraries integrated within the software for compound identification. All the reagents used were sourced from Pascual Pharma Corp Laboratory (Philippines).</p>
</sec>
<sec id="s2-6-2">
<title>Proximate analysis</title>
<p>The ash, moisture, crude protein, crude fiber, total carbohydrate and total dietary fiber of <italic>Odontosoria biflora</italic> were outsourced in another institution (Department of Science and Technology-Industrial Technology Development Institute and National Institute of Molecular Biology and Biotechnology (BIOTECH), University of the Philippines, Los Ba&#xf1;os.</p>
<sec id="s2-6-2-1">
<title>Ash</title>
<p>The ash content of <italic>O. biflora</italic> was analyzed using the gravimetric method following AOAC Method 923.03 (modified, 21st ed.) (<xref ref-type="bibr" rid="B7">AOAC, 2019</xref>). About 2.0&#xa0;g of the sample was placed in a porcelain crucible and heated in a furnace at 550&#xa0;&#xb0;C for 2&#xa0;h. After cooling in a desiccator for 30&#xa0;min, the crucible was weighed, and the final mass was recorded. The ash content was expressed as a percentage.</p>
</sec>
<sec id="s2-6-2-2">
<title>Moisture</title>
<p>The moisture content of <italic>O. biflora</italic> was measured using the air-oven method in accordance with AOAC Method 925.45B (modified, 21st ed.) (<xref ref-type="bibr" rid="B7">AOAC, 2019</xref>). About 2.0&#xa0;g of the sample was placed in an aluminum dish and dried in an oven at 105&#xa0;&#xb0;C for 2&#xa0;h. After cooling in a desiccator for 30&#xa0;min, the dish was weighed, and the final mass was recorded. The moisture content was expressed as a % moisture.</p>
</sec>
<sec id="s2-6-2-3">
<title>Crude protein</title>
<p>The crude protein content was quantified using the Kjeldahl method, following AOAC Official Method 923.03 (modified, 21st ed.) (<xref ref-type="bibr" rid="B7">AOAC, 2019</xref>). The Kjeldahl nitrogen percentage and crude protein content were calculated using the formulas:<disp-formula id="equ3">
<mml:math id="m3">
<mml:mrow>
<mml:mtext>Kjeldahl&#x2009;&#x2009;nitrogen</mml:mtext>
<mml:mo>,</mml:mo>
<mml:mo>%</mml:mo>
<mml:mo>&#x3d;</mml:mo>
<mml:mfrac>
<mml:mrow>
<mml:mrow>
<mml:mfenced open="(" close=")" separators="|">
<mml:mrow>
<mml:mtext>Vs</mml:mtext>
<mml:mo>&#x2212;</mml:mo>
<mml:mtext>VB</mml:mtext>
</mml:mrow>
</mml:mfenced>
</mml:mrow>
<mml:mtext>&#x2009;</mml:mtext>
<mml:mi mathvariant="normal">&#x00D7;</mml:mi>
<mml:mtext>&#x2009;</mml:mtext>
<mml:mi mathvariant="normal">M</mml:mi>
<mml:mtext>&#x2009;</mml:mtext>
<mml:mi mathvariant="normal">&#x00D7;</mml:mi>
<mml:mtext>&#x2009;</mml:mtext>
<mml:mn>14.01</mml:mn>
<mml:mtext>&#x2009;</mml:mtext>
</mml:mrow>
<mml:mrow>
<mml:mi mathvariant="normal">W</mml:mi>
<mml:mtext>&#x2009;</mml:mtext>
<mml:mi mathvariant="normal">&#x00D7;</mml:mi>
<mml:mtext>&#x2009;</mml:mtext>
<mml:mn>10</mml:mn>
</mml:mrow>
</mml:mfrac>
</mml:mrow>
</mml:math>
</disp-formula>
</p>
<p>Crude protein, % &#x3d; % Kjeldahl Nitrogen &#x00D7; F (Conversion factor from nitrogen to protein)</p>
<p>Where Vs is the volume of standardized acid used to titrate the sample; VB is the volume of standardized acid used to titrate the reagent blank; M is the molarity of the standard HCl; 14.01 is the atomic weight of Nitrogen; 10 is the factor to convert mg/g to percent; and W is the weight of the sample.</p>
</sec>
<sec id="s2-6-2-4">
<title>Crude fiber</title>
<p>Crude fiber content was determined using the K&#xfc;rschner&#x2013;Hanak method, as described by <xref ref-type="bibr" rid="B15">Cvrk et al. (2022)</xref>. From the homogenized bulk sample, 1.000&#xa0;g was transferred into a 100-mL round-bottom flask, followed by the addition of 25&#xa0;mL of 80% (v/v) acetic acid and 2.5&#xa0;mL of concentrated nitric acid. The mixture was heated under reflux for 30 min, filtered hot through a G-3 sintered glass crucible, and the residue was sequentially washed with acetic&#x2013;nitric acid mixture, hot water, ethanol, and diethyl ether. The residue was dried at 105&#xa0;&#xb0;C for 30&#xa0;min, cooled in a desiccator, and weighed. Crude fiber content was calculated as:<disp-formula id="equ4">
<mml:math id="m4">
<mml:mrow>
<mml:mtext>Crude&#x2009;&#x2009;fiber&#x2009;&#x2009;content&#x2009;</mml:mtext>
<mml:mrow>
<mml:mfenced open="(" close=")" separators="|">
<mml:mrow>
<mml:mo>%</mml:mo>
</mml:mrow>
</mml:mfenced>
</mml:mrow>
<mml:mo>&#x3d;</mml:mo>
<mml:mfrac>
<mml:mrow>
<mml:mi>a</mml:mi>
<mml:mo>&#xd7;</mml:mo>
<mml:mn>100</mml:mn>
</mml:mrow>
<mml:mi>W</mml:mi>
</mml:mfrac>
</mml:mrow>
</mml:math>
</disp-formula>where <italic>a</italic> a is the mass of the dried fiber residue (g) and <italic>W</italic> is the initial sample weight (g).</p>
</sec>
<sec id="s2-6-2-5">
<title>Total carbohydrate</title>
<p>Proximate parameters (carbohydrate, fats, protein and ash) of the plant <italic>O. biflora</italic> were determined using the Association of Official Analytical Chemists (<xref ref-type="bibr" rid="B7">AOAC, 2019</xref>) method. The nitrogen content of the samples was determined by the micro-Kjeldahl method. The nitrogen value obtained was multiplied by 6.25 to convert it to crude protein. The weight difference methods were used to determine moisture and ash content levels while crude fat of the plant was determined using the AOAC procedure with petroleum ether as solvent. The carbohydrate content was determined by calculation using the different method:<disp-formula id="equ5">
<mml:math id="m5">
<mml:mrow>
<mml:mo>%</mml:mo>
<mml:mtext>Total&#x2009;Carbohydrate</mml:mtext>
<mml:mo>&#x3d;</mml:mo>
<mml:mn>100</mml:mn>
<mml:mo>&#x2212;</mml:mo>
<mml:mo>%</mml:mo>
<mml:mtext>&#x2009;</mml:mtext>
<mml:mrow>
<mml:mfenced open="(" close=")" separators="|">
<mml:mrow>
<mml:mtext>Protein</mml:mtext>
<mml:mo>&#x2b;</mml:mo>
<mml:mtext>Fat</mml:mtext>
<mml:mo>&#x2b;</mml:mo>
<mml:mtext>Moisture</mml:mtext>
<mml:mo>&#x2b;</mml:mo>
<mml:mtext>Ash</mml:mtext>
<mml:mo>&#x2b;</mml:mo>
<mml:mtext>Crude&#x2009;Fiber</mml:mtext>
</mml:mrow>
</mml:mfenced>
</mml:mrow>
</mml:mrow>
</mml:math>
</disp-formula>
</p>
</sec>
<sec id="s2-6-2-6">
<title>Crude fat</title>
<p>The crude fat content of <italic>O. biflora</italic> was determined in accordance with AOAC Method 2003.05 (modified, 21st ed.) (<xref ref-type="bibr" rid="B7">AOAC, 2019</xref>). Approximately 2&#xa0;g of the sample was placed into a tared extraction thimble and dried at 102&#xa0;&#xb0;C for 30&#xa0;min. The thimble was then immersed in solvent and boiled for a minimum of 20&#xa0;min, followed by extraction for 40&#xa0;min. Afterward, the solvent was evaporated, and the extracted oil was quantified gravimetrically by difference in weight.</p>
</sec>
<sec id="s2-6-2-7">
<title>Dietary fiber</title>
<p>Dietary fiber analysis followed modified AOAC Official Method 991.43 (<xref ref-type="bibr" rid="B7">AOAC, 2019</xref>). A 1&#xa0;g homogenized <italic>O. biflora</italic> sample was mixed with 40&#xa0;mL MES-TRIS buffer (pH 8.2) and stirred until fully dispersed. After adding 50&#xa0;&#xb5;L alpha-amylase, the mixture was incubated at 95&#xa0;&#xb0;C&#x2013;100&#xa0;&#xb0;C for 15&#xa0;min with agitation, then cooled to 60&#xa0;&#xb0;C. Protease (10&#xa0;&#xb5;L) was added and incubated for 30&#xa0;min at 60&#xa0;&#xb0;C. The pH was adjusted to 4.0&#x2013;4.7 using 5&#xa0;mL of 0.561N HCl and 1N NaOH, followed by the addition of 300&#xa0;&#xb5;L amyloglucosidase and incubation at 60.1&#xa0;&#xb0;C for 30&#xa0;min. To precipitate dietary fiber, 225&#xa0;mL of 95% ethanol was added at 60&#xa0;&#xb0;C, then the sample was left at room temperature for 1&#xa0;hour. A Celite bed in a tared crucible was prepared with 15&#xa0;mL of 78% ethanol, and vacuum filtration was performed. The enzyme digestate was filtered, and residues were washed twice with 78% ethanol, 95% ethanol, and acetone. The crucible was dried overnight at 105&#xa0;&#xb0;C, cooled in a desiccator for 1&#xa0;hour, and weighed. The dietary fiber residue was calculated by subtracting the weight of the empty crucible containing only Celite.</p>
</sec>
</sec>
</sec>
<sec id="s2-7">
<title>Statistical analysis</title>
<p>Statistical analysis for the <italic>in vitro</italic> bacterial growth assay was conducted using two-way ANOVA followed by Dunnett&#x2019;s multiple comparison test. Quantitative PCR data were analyzed using two way RM-ANOVA followed by Dunnetts test. A p-value &#x3c;0.05 was considered statistically significant. All statistical test were performed using GraphPad Prism version 10.5.0.</p>
</sec>
</sec>
<sec sec-type="results" id="s3">
<title>Results</title>
<sec id="s3-1">
<title>Effect of the different extracts of O. biflora on the growth of A. muciniphila <italic>in vitro</italic>
</title>
<p>To identify the most active <italic>O. biflora</italic> extract on the growth of <italic>A. muciniphila in vitro</italic>, <italic>O. biflora</italic> extracts were evaluated using fractions obtained from sequential extraction, which are labeled in <xref ref-type="fig" rid="F2">Figure 2</xref> as AQ (<italic>O. biflora</italic> aqueous extract), ETAC (<italic>O. biflora</italic> ethyl acetate extract), MEOH (<italic>O. biflora</italic> methanolic extract), and HEX (<italic>O. biflora</italic> hexane extract). The bacterial strain was cultured in modified Brain-Heart Infusion (BHI) medium, with and without glucose-supplemented OBE, at 250&#xa0;mg/L and 500&#xa0;mg/L, and growth was assessed via OD620 measurements while <italic>A. muciniphila</italic> cultured in BHI and no OBE supplementation serve as the control (CTRL). At 250&#xa0;mg/L, OBE-HEX increased <italic>A. muciniphila</italic> growth to 56.43% compared with 11.92% in the control (<italic>p</italic> &#x3c; 0.05). At 500&#xa0;mg/L, growth further increased to 85.62% (<italic>p</italic> &#x3c; 0.001) (<xref ref-type="fig" rid="F2">Figure 2</xref>). Therefore, the OBE HEX was used in the subsequent assays.</p>
<fig id="F2" position="float">
<label>FIGURE 2</label>
<caption>
<p>Effect of the different extracts of <italic>O. biflora</italic> on the growth of <italic>A. muciniphila</italic>. The percentage relative growth yield of <italic>Akkermansia muciniphila</italic> cultured in Brain-Heart Infusion (BHI) medium, supplemented with <italic>Odontosoria biflora</italic> extract (OBE) obtained using different extraction solvents, namely aqueous (AQ), ethyl acetate (ETAC), methanol (MEOH), and hexane (HEX), is presented. The bacterial strain was cultivated in BHI medium, with and without glucose-supplemented OBE, at final concentrations of 250&#xa0;mg/mL and 500&#xa0;mg/mL, and its growth was assessed via OD620 measurements. The experiment was conducted in three independent trials, each performed in triplicate. Statistical significance relative to the control is indicated by asterisks (p &#x2264; 0.05).</p>
</caption>
<graphic xlink:href="abp-73-16199-g002.tif">
<alt-text content-type="machine-generated">Bar graph showing percent relative growth yield of A. muciniphila for five extraction solvents (CTRL, AQ, ETAC, MEOH, HEX) at two concentrations (250 milligrams per liter and 500 milligrams per liter). HEX and MEOH solvents yield the highest growth, notably at 500 milligrams per liter, while CTRL yields the lowest. Statistical significance is indicated for several comparisons.</alt-text>
</graphic>
</fig>
</sec>
<sec id="s3-2">
<title>Acute oral toxicity assay</title>
<p>All mice administered a single oral dose of <italic>O</italic>. <italic>biflora</italic> hexane extract (OBE-HEX) at 250, 500, 1,000, or 2000&#xa0;mg/kg body weight survived and showed no treatment-related clinical signs, behavioral changes, or body-weight loss throughout the 14-day observation period. In accordance with OECD Test No. 423, the extract was well tolerated at the limit dose of 2000&#xa0;mg/kg. This safety profile supported the selection of 250&#xa0;mg/kg and 500&#xa0;mg/kg as the low- and high-dose levels, respectively, for subsequent <italic>in vivo</italic> assays.</p>
</sec>
<sec id="s3-3">
<title>Effect of OBE on fecal abundance of <italic>Akkermanisia muciniphila</italic>
</title>
<p>Quantitative real-time PCR (qPCR) analysis targeting <italic>A. muciniphila</italic> was performed on fecal DNA to assess relative changes in <italic>A. muciniphila&#x2013;</italic>specific qPCR signal across treatment groups and time points. At week 0, the DM &#x2b; Met and DM &#x2b; LOBE groups exhibited the highest relative detection level of <italic>A. muciniphila</italic> (p &#x3c; 0.05 and p &#x3c; 0.001, respectively) compared with the other groups. By week 1, a decline in relative qPCR signal was observed in the N &#x2b; OBE, DM, DM &#x2b; Met, and DM &#x2b; LOBE groups, whereas the DM &#x2b; HOBE group demonstrated a significant increase qPCR signal relative to N (p &#x3c; 0.05). At week 2, both the DM (p &#x3c; 0.01) and DM &#x2b; HOBE (p &#x3c; 0.05) groups showed marked increases in <italic>A. muciniphila</italic> relative qPCR signal, while DM &#x2b; LOBE groups exhibited pronounced downregulation, resulting in the lowest values among all treatments. By week <italic>4, A. muciniphila</italic> levels had declined across most groups, with only the DM &#x2b; Met group maintaining significantly elevated relative qPCR signal (p &#x3c; 0.01). In contrast, the DM, DM &#x2b; LOBE, and DM &#x2b; HOBE groups displayed lower expression levels, and the N &#x2b; OBE group showed the lowest detection overall (<xref ref-type="fig" rid="F3">Figure 3</xref>).</p>
<fig id="F3" position="float">
<label>FIGURE 3</label>
<caption>
<p>Relative <italic>Akkermansia muciniphila</italic>-specific signal in fecal samples of BALB/c mice. Relative detection levels were quantified using a modified 2<sup>&#x2212;</sup>&#x394;&#x394;Ct approach with external <italic>A. muciniphila</italic> ATCC genomic DNA as reference and the normal group as biological calibrator. Data represented as mean &#xb1; SE. Statistical significance was determined by two-way repeated-measures ANOVA followed by Dunnett&#x2019;s multiple comparisons test (<italic>p</italic> &#x3c; 0.05, p &#x3c; 0.01, <italic>p</italic> &#x3c; 0.001).</p>
</caption>
<graphic xlink:href="abp-73-16199-g003.tif">
<alt-text content-type="machine-generated">Bar graph showing relative fecal A. muciniphila qPCR signal over weeks zero, one, two, and four for six groups: N (blue), N+OBE (green), DM (red), DM+Met (yellow), DM+LOBE (purple), and DM+HOBE (maroon). Statistical significance is indicated by asterisks above some bars. Error bars represent variability.</alt-text>
</graphic>
</fig>
</sec>
<sec id="s3-4">
<title>Metabolite profiling and proximate analysis of O.biflora</title>
<p>The metabolite profiling of OBE HEX was analyzed using high-resolution ultra-performance liquid chromatography coupled with electrospray ionization/quadrupole time-of-flight mass spectrometry (HR-UPLC-ESI-QTOF-MS) to obtain an untargeted overview of the extract constituents. Data acquisition was performed with MassLynx 4.2 software (mass range: 50&#x2013;1,500&#xa0;Da). RAW files were converted to ABF using Reifycs ABF Converter for further analysis. Peak alignment, detection, and identification were conducted using MS-DIAL (v4.9) with MS/MS-Pos libraries. Representative base peak ion chromatograms (BPI) from injections of each OBE extract (<xref ref-type="fig" rid="F4">Figures 4B&#x2013;E</xref>). Peak annotations correspond to the most intense retention time in each spectrum, representing distinct sample components.</p>
<fig id="F4" position="float">
<label>FIGURE 4</label>
<caption>
<p>LC&#x2013;MS/MS of hexane extract of <italic>O. biflora</italic>. <bold>(A)</bold> Chemical structure of 2-O-Rhamnosylvitexin and 7-methoxy-9,10- dihydrophenanthrene-2,5-diol <bold>(B)</bold> MS1Chromatograms Base Peak Intensities <bold>(C)</bold> MS2 Chromatograms Base Peak Intensities <bold>(D)</bold> PDA UV Chromatograms <bold>(E)</bold> Total Ion Chromatograms.</p>
</caption>
<graphic xlink:href="abp-73-16199-g004.tif">
<alt-text content-type="machine-generated">Panel A shows chemical structures of 2-O-Rhamnosylvitexin and 7-methoxy-9,10-dihydrophenanthrene-2,5-diol. Panels B, C, D, and E display chromatograms with chemical peaks marked at various retention times used for compound identification.</alt-text>
</graphic>
</fig>
<p>Two metabolites were putatively identified in OBE HEX based on spectral similarity to reference library entries: 2-O-Rhamnosylvitexin (retention time 1.922&#xa0;min, m/z 579.1639) and 7-methoxy-9,10-dihydrophenanthrene-2,5-diol (retention time 7.613&#xa0;min, m/z 243.1008) (<xref ref-type="fig" rid="F4">Figure 4A</xref>). The identifications are tentative and were not confirmed by authentic standards or quantitative analysis.</p>
<p>The proximate analysis of whole plant <italic>O. biflora</italic> showed a moisture content of 3.31% &#xb1; 0.01%, crude fiber of 16.8%, crude protein of 2.86% &#xb1; 0.08%, and an ash content of 4.64% &#xb1; 0.04%. Total carbohydrates accounted for 60.32% of the dry weight, and total dietary fiber content was 65.1&#xa0;g dry sample (<xref ref-type="table" rid="T2">Table 2</xref>). These values describe the nutritional composition of the whole plant material and do not represent the chemical composition of the hexane extract used in biological assays.</p>
<table-wrap id="T2" position="float">
<label>TABLE 2</label>
<caption>
<p>Proximate composition and dietary fiber of <italic>O. biflora</italic>.</p>
</caption>
<table>
<thead valign="top">
<tr>
<th align="left">Parameters</th>
<th align="left">Quantity</th>
</tr>
</thead>
<tbody valign="top">
<tr>
<td align="left">Carbohydrates</td>
<td align="left">60.32%</td>
</tr>
<tr>
<td align="left">Ash</td>
<td align="left">4.64% &#xb1; 0.04%</td>
</tr>
<tr>
<td align="left">Moisture</td>
<td align="left">12.07% &#xb1; 0.03%</td>
</tr>
<tr>
<td align="left">Fat</td>
<td align="left">3.31% &#xb1; 0.01%</td>
</tr>
<tr>
<td align="left">Crude protein</td>
<td align="left">2.86% &#xb1; 0.08%</td>
</tr>
<tr>
<td align="left">Crude fiber</td>
<td align="left">16.8%</td>
</tr>
<tr>
<td align="left">Dietary fiber</td>
<td align="left">65.1&#xa0;g</td>
</tr>
</tbody>
</table>
</table-wrap>
</sec>
</sec>
<sec sec-type="discussion" id="s4">
<title>Discussion</title>
<sec id="s4-1">
<title>Effect of the different extracts of <italic>O. biflora</italic> on the growth of <italic>A. muciniphila in vitro</italic>
</title>
<p>The ability of the <italic>Odontosoria biflora</italic> hexane extract (OBE HEX) to promote <italic>A. muciniphila</italic> growth (<xref ref-type="fig" rid="F2">Figure 2</xref>) suggests that this fern contains lipophilic or semi-polar metabolites capable of supporting bacterial proliferation under controlled anaerobic conditions. Similar growth-supporting effects have been reported for plant-derived phytochemicals in simplified culture systems, where nutrient availability and redox condition are optimized for bacterial metabolism (<xref ref-type="bibr" rid="B46">Xia et al., 2021</xref>; <xref ref-type="bibr" rid="B35">Rodr&#xed;guez-Daza and de Vos, 2022</xref>). These findings suggest that the bioactive constituents of OBE-HEX may exert a prebiotic effect by selectively promoting the growth of <italic>A. muciniphila</italic>. Importantly, the <italic>in vitro</italic> assay was conducted under controlled culture conditions to identify extract fractions with direct growth-supporting activity toward <italic>A. muciniphila</italic>, and it is not intended to replicate the complexity of intestinal exposure <italic>in vivo</italic>. Therefore, the observed stimulation should be interpreted as an extract-dependent effect in a simplified system and does not, by itself, imply sustained enrichment or functional modulation of <italic>A. muciniphila</italic> within the gut.</p>
</sec>
<sec id="s4-2">
<title>Acute oral toxicity assay</title>
<p>The acute oral toxicity assessment demonstrated that <italic>O. biflora</italic> hexane extract (OBE-HEX) produced no mortality, behavioral abnormalities, or adverse clinical signs up to 2000&#xa0;mg/kg, indicating a wide safety margin in accordance with (<xref ref-type="bibr" rid="B32">OECD Test No. 423, 2002</xref>). The absence of toxic manifestations is consistent with findings from other medicinal plant extract such as <italic>Clerodendrum viscosum</italic> and <italic>Leucas indica</italic> (<xref ref-type="bibr" rid="B12">Chandrashekar et al., 2022</xref>). These results support the suitability of the extract for subsequent metabolic studies and justify the use of 250 and 500&#xa0;mg/kg as biologically tolerable <italic>in vivo</italic> doses.</p>
</sec>
<sec id="s4-3">
<title>Effect of OBE on fecal abundance of Akkermansia muciniphila</title>
<p>Fecal qPCR analysis demonstrated that <italic>A. muciniphila</italic> did not exhibit sustained enrichment in extract-treated groups despite pronounced growth stimulation observed <italic>in vitro</italic>. Rather than indicating lack of biological activity, this divergence underscores the context-dependent nature of microbial responses and highlights the limitations of extrapolating culture-based findings to the host gut environment, where ecological and host-mediated constraints govern bacterial persistence.</p>
<p>
<italic>In vitro</italic>, the hexane fraction of <italic>Odontosoria biflora</italic> robustly promoted <italic>A. muciniphila</italic> growth in a dose-responsive manner, indicating the presence of bioactive lipophilic or semi-polar metabolites capable of directly supporting bacterial proliferation under controlled anaerobic conditions. Similar effects have been reported for plant-derived phytochemicals in simplified culture systems, where nutrient availability and redox conditions favor mucinolytic metabolism (<xref ref-type="bibr" rid="B46">Xia et al., 2021</xref>; <xref ref-type="bibr" rid="B35">Rodr&#xed;guez-Daza and de Vos, 2022</xref>). In contrast, maintenance of <italic>A. muciniphila in vivo</italic> is influenced by additional factors such as mucin availability, epithelial turnover, host immune regulation, and microbial competition, which collectively shape colonization dynamics and limit sustained mono-taxon expansion (<xref ref-type="bibr" rid="B11">Cani and de Vos, 2017</xref>; <xref ref-type="bibr" rid="B28">Liu et al., 2024</xref>).</p>
<p>In the high-dose extract group (DM &#x2b; HOBE), a transient increase in <italic>A. muciniphila</italic> qPCR signal was observed early during treatment, followed by a decline at later time points. This pattern suggests that OBE-derived metabolites may initially favor <italic>A. muciniphila</italic> detection under diabetic conditions but are insufficient to maintain prolonged enrichment. Similar transient responses have been reported following polyphenol-rich dietary interventions, where short-term increases in <italic>A. muciniphila</italic> do not necessarily translate into sustained colonization (<xref ref-type="bibr" rid="B5">Anh&#xea; et al., 2015</xref>; <xref ref-type="bibr" rid="B48">Jeong et al., 2020</xref>). Importantly, because no community-wide or functional microbiome analyses were performed, inferences regarding broader ecological restructuring cannot be drawn from the present data.</p>
<p>In contrast, the low-dose extract group (DM &#x2b; LOBE) exhibited a progressive reduction in <italic>A. muciniphila</italic> qPCR signal, which may reflect insufficient exposure to bioactive metabolites to support detectable persistence under <italic>in vivo</italic> conditions. These findings emphasize that extract dose influences the magnitude and direction of <italic>A. muciniphila</italic>&#x2013;specific responses, while also highlighting the sensitivity of fecal qPCR measurements to host and environmental factors in diabetic models.</p>
<p>The metformin-treated group showed sustained elevation of <italic>A. muciniphila</italic> by the final time point, consistent with prior reports linking metformin to enrichment of mucin-degrading bacteria through host-mediated mechanisms, including altered intestinal glucose flux and bile acid metabolism (<xref ref-type="bibr" rid="B22">Forslund et al., 2015</xref>; <xref ref-type="bibr" rid="B16">de la Cuesta-Zuluaga et al., 2017</xref>; <xref ref-type="bibr" rid="B45">Wu et al., 2017</xref>). This contrast further underscores that persistent <italic>in vivo</italic> enrichment of <italic>A. muciniphila</italic> is treatment-specific and not solely attributable to direct bacterial growth promotion observed <italic>in vitro</italic>.</p>
<p>Overall, these findings demonstrate that while <italic>O. biflora</italic> hexane extract strongly stimulates <italic>A. muciniphila</italic> growth under controlled <italic>in vitro</italic> conditions, its <italic>in vivo</italic> effects on fecal <italic>A. muciniphila</italic> detection are transient and context dependent. The observed qPCR trends reflect the complexity of host&#x2013;microbe interactions rather than evidence of sustained enrichment or broad microbiota modulation. Accordingly, conclusions are limited to <italic>A. muciniphila</italic>&#x2013;specific responses, and further studies incorporating community-level and functional analyses are required to determine whether <italic>O. biflora</italic> extract exerts wider microbiome or host-mediated metabolic effects.</p>
</sec>
<sec id="s4-4">
<title>Phytochemical profiling and proximate analysis of O. biflora</title>
<p>The metabolites and proximate analysis of <italic>Odontosoria biflora</italic> provide a contextual information for interpreting the divergent <italic>in vitro</italic> and <italic>in vivo</italic> observations obtained in this study, while also highlighting important boundaries in data interpretation. Untargeted LC-MS analysis of the hexane extract yielded putative identification of two prominent metabolites, 2-O-rhamnosylvitexin (vitexin 2&#x2033;-O-rhamnoside) and 7-methoxy-9,10-dihydrophenanthrene-2,5-diol (lusianthridin) based on spectral similarity to database entries. As these compounds were neither structurally confirmed nor quantified, the chemical analysis should be regarded as exploratory and hypothesis-generating rather than definitive.</p>
<p>Vitexin-2&#x2033;-O-rhamnoside is a flavone C-glycoside commonly reported in plant extracts with microbiota-modulating potential, whereas lusianthridin belongs to the dihydrophenanthrene class of phenanthrenoids known for biological activity in microbial and host systems (<xref ref-type="bibr" rid="B33">Qi et al., 2021</xref>; <xref ref-type="bibr" rid="B42">Tang et al., 2024</xref>). Although no direct causal relationship between individual metabolites and <italic>A</italic>. <italic>muciniphila</italic> growth was established in the present study. The observed <italic>in vitro</italic> growth stimulation therefore reflects extract-level bioactivity under controlled culture conditions rather than the action of specific, validated compounds.</p>
<p>Importantly, the proximate composition data describe the nutritional characteristics of the whole <italic>O. biflora</italic> plant and are not directly applicable to the hexane extract evaluated <italic>in vitro</italic> and <italic>in vivo</italic>. In particular, dietary fiber and complex carbohydrates are unlikely to be present in the hexane fraction and should not be interpreted as contributors to the observed extract-dependent effects. Accordingly, biological responses associated with OBE-HEX are most plausibly attributed to lipophilic or semi-polar constituents detected by LC-MS, rather than to bulk nutritional components of the plant material.</p>
<p>The lack of sustained <italic>in vivo</italic> enrichment of <italic>A. muciniphila</italic>, despite pronounced <italic>in vitro</italic> growth stimulation, further underscores the context-dependent nature of microbial responses. While OBE-HEX demonstrated direct growth-supporting activity in culture, qPCR analysis revealed only transient changes in fecal <italic>A. muciniphila</italic> detection, consistent with known host-mediated and ecological constraints governing bacterial persistence in the gut environment (<xref ref-type="bibr" rid="B11">Cani and de Vos, 2017</xref>; <xref ref-type="bibr" rid="B28">Liu et al., 2024</xref>). Because no community-wide or functional microbiome analyses were performed, conclusions are limited to species-specific responses and do not support claims of broader microbiota modulation or ecological restructuring.</p>
<p>Taken together, these findings support a model in which <italic>O. biflora</italic> hexane extract exhibits extract-level bioactivity toward <italic>A. muciniphila</italic> under simplified <italic>in vitro</italic> conditions, while <italic>in vivo</italic> outcomes are constrained by host and environmental factors. This reinforces the importance of cautious interpretation of culture-based screening results and highlights the need for future studies incorporating targeted chemical validation, community-level microbiome analyses, and host metabolic endpoints.</p>
</sec>
<sec id="s4-5">
<title>Conclusions</title>
<p>In conclusion, <italic>Odontosoria biflora</italic> hexane extract (OBE-HEX) is orally well tolerated and exhibits direct growth-supporting activity toward <italic>A. muciniphila in vitro</italic>, but this effect does not translate into sustained <italic>in vivo</italic> enrichment under diabetic conditions. The observed divergence underscores the limitations of extrapolating culture-based microbiota screening results to host-associated systems and highlights the role of host-dependent ecological constraints. Further studies integrating expanded microbiome analyses and targeted chemical validation are needed to clarify the biological relevance of these findings.</p>
</sec>
</sec>
</body>
<back>
<sec sec-type="data-availability" id="s5">
<title>Data availability statement</title>
<p>The data generated during this study are available in Figshare at <ext-link ext-link-type="uri" xlink:href="https://doi.org/10.6084/m9.figshare.31287289">https://doi.org/10.6084/m9.figshare.31287289</ext-link>.</p>
</sec>
<sec sec-type="ethics-statement" id="s6">
<title>Ethics statement</title>
<p>The study was conducted in accordance with the guidelines of the University of the Philippines Manila and was classified as exempt by the University of the Philippines Manila Research Ethics Board (UPMREB) with protocol code UPMREB 2024-0069-EX, approved on 16 July 2024. The study was conducted in accordance with the local legislation and institutional requirements.</p>
</sec>
<sec sec-type="author-contributions" id="s7">
<title>Author contributions</title>
<p>MH conceived and designed the study, led and executed the <italic>in vitro</italic> and <italic>in vivo</italic> experiments, performed data analysis and interpretation, and wrote the original draft of the manuscript. LD served as the supervising adviser, provided scientific oversight and critical guidance throughout the study, reviewed and validated the experimental design and results, and contributed to critical revision of the manuscript. All authors contributed to the article and approved the submitted version.</p>
</sec>
<ack>
<title>Acknowledgements</title>
<p>We extend our appreciation to Dr. Gracia Fe B. Yu, Dr. Cecilia Jimeno, Dr. Fatima Ericka Vista and Dr. Saeid Hokmalipor for their valuable contributions.</p>
</ack>
<sec sec-type="COI-statement" id="s9">
<title>Conflict of interest</title>
<p>The author(s) declared that this work was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.</p>
</sec>
<sec sec-type="ai-statement" id="s10">
<title>Generative AI statement</title>
<p>The author(s) declared that generative AI was not used in the creation of this manuscript.</p>
<p>Any alternative text (alt text) provided alongside figures in this article has been generated by Frontiers with the support of artificial intelligence and reasonable efforts have been made to ensure accuracy, including review by the authors wherever possible. If you identify any issues, please contact us.</p>
</sec>
<ref-list>
<title>References</title>
<ref id="B1">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Al-Awar</surname>
<given-names>A.</given-names>
</name>
<name>
<surname>Kupai</surname>
<given-names>K.</given-names>
</name>
<name>
<surname>Veszelka</surname>
<given-names>M.</given-names>
</name>
<name>
<surname>Sz&#x171;cs</surname>
<given-names>G.</given-names>
</name>
<name>
<surname>Attieh</surname>
<given-names>Z.</given-names>
</name>
<name>
<surname>Murlasits</surname>
<given-names>Z.</given-names>
</name>
<etal/>
</person-group> (<year>2016</year>). <article-title>Experimental diabetes mellitus in different animal models</article-title>. <source>J. Diabetes Research</source> <volume>2016</volume>, <fpage>9051426</fpage>. <pub-id pub-id-type="doi">10.1155/2016/9051426</pub-id>
<pub-id pub-id-type="pmid">27595114</pub-id>
</mixed-citation>
</ref>
<ref id="B2">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Ali</surname>
<given-names>M. S.</given-names>
</name>
<name>
<surname>Lee</surname>
<given-names>E.-B.</given-names>
</name>
<name>
<surname>Lee</surname>
<given-names>S.-J.</given-names>
</name>
<name>
<surname>Lee</surname>
<given-names>S.-P.</given-names>
</name>
<name>
<surname>Boby</surname>
<given-names>N.</given-names>
</name>
<name>
<surname>Suk</surname>
<given-names>K.</given-names>
</name>
<etal/>
</person-group> (<year>2021</year>). <article-title>Aronia melanocarpa extract fermented by Lactobacillus plantarum EJ2014 modulates immune response in mice</article-title>. <source>Antioxidants</source> <volume>10</volume> (<issue>8</issue>), <fpage>1276</fpage>. <pub-id pub-id-type="doi">10.3390/antiox10081276</pub-id>
<pub-id pub-id-type="pmid">34439524</pub-id>
</mixed-citation>
</ref>
<ref id="B3">
<mixed-citation publication-type="journal">
<collab>American Diabetes Association Professional Practice Committee</collab> (<year>2024</year>). <article-title>2. Diagnosis and classification of diabetes: standards of care in Diabetes-2024</article-title>. <source>Diabetes Care</source> <volume>47</volume> (<issue>Suppl. 1</issue>), <fpage>S20</fpage>&#x2013;<lpage>S42</lpage>. <pub-id pub-id-type="doi">10.2337/dc24-S002</pub-id>
<pub-id pub-id-type="pmid">38078589</pub-id>
</mixed-citation>
</ref>
<ref id="B4">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>An</surname>
<given-names>L.</given-names>
</name>
<name>
<surname>Wirth</surname>
<given-names>U.</given-names>
</name>
<name>
<surname>Koch</surname>
<given-names>D.</given-names>
</name>
<name>
<surname>Schirren</surname>
<given-names>M.</given-names>
</name>
<name>
<surname>Drefs</surname>
<given-names>M.</given-names>
</name>
<name>
<surname>Koliogiannis</surname>
<given-names>D.</given-names>
</name>
<etal/>
</person-group> (<year>2022</year>). <article-title>The role of gut-derived lipopolysaccharides and the intestinal barrier in fatty liver diseases</article-title>. <source>J. Gastrointestinal Surgery Official Journal Soc. Surg. Alimentary Tract</source> <volume>26</volume> (<issue>3</issue>), <fpage>671</fpage>&#x2013;<lpage>683</lpage>. <pub-id pub-id-type="doi">10.1007/s11605-021-05188-7</pub-id>
<pub-id pub-id-type="pmid">34734369</pub-id>
</mixed-citation>
</ref>
<ref id="B5">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Anh&#xea;</surname>
<given-names>F. F.</given-names>
</name>
<name>
<surname>Roy</surname>
<given-names>D.</given-names>
</name>
<name>
<surname>Pilon</surname>
<given-names>G.</given-names>
</name>
<name>
<surname>Dudonn&#xe9;</surname>
<given-names>S.</given-names>
</name>
<name>
<surname>Matamoros</surname>
<given-names>S.</given-names>
</name>
<name>
<surname>Varin</surname>
<given-names>T. V.</given-names>
</name>
<etal/>
</person-group> (<year>2015</year>). <article-title>A polyphenol-rich cranberry extract protects from diet-induced obesity, insulin resistance and intestinal inflammation in association with increased akkermansia spp. population in the gut microbiota of mice</article-title>. <source>Gut</source> <volume>64</volume> (<issue>6</issue>), <fpage>872</fpage>&#x2013;<lpage>883</lpage>. <pub-id pub-id-type="doi">10.1136/gutjnl-2014-307142</pub-id>
<pub-id pub-id-type="pmid">25080446</pub-id>
</mixed-citation>
</ref>
<ref id="B6">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Aslam</surname>
<given-names>H.</given-names>
</name>
<name>
<surname>Khan</surname>
<given-names>A.</given-names>
</name>
<name>
<surname>Rehman</surname>
<given-names>N.</given-names>
</name>
<name>
<surname>Ali</surname>
<given-names>F.</given-names>
</name>
<name>
<surname>Nadeem</surname>
<given-names>H.</given-names>
</name>
<name>
<surname>Majid Shah</surname>
<given-names>S.</given-names>
</name>
</person-group> (<year>2017</year>). <article-title>Anti-hyperglycemic activity of Heliotropium strigosum (boraginaecae) whole plant extract in alloxan-induced diabetic mice</article-title>. <source>Trop. J. Pharm. Res.</source> <volume>16</volume>, <fpage>2425</fpage>&#x2013;<lpage>2430</lpage>. <pub-id pub-id-type="doi">10.4314/tjpr.v16i10.16</pub-id>
</mixed-citation>
</ref>
<ref id="B7">
<mixed-citation publication-type="book">
<collab>Association of Official Analytical Chemists</collab> (<year>2019</year>). <source>Official methods of analysis of AOAC international</source> (<edition>21st ed.</edition>). <publisher-loc>Gaithersburg, MD</publisher-loc>: <publisher-name>AOAC International</publisher-name>.</mixed-citation>
</ref>
<ref id="B8">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Barik</surname>
<given-names>S. K.</given-names>
</name>
<name>
<surname>Sengupta</surname>
<given-names>S.</given-names>
</name>
<name>
<surname>Arya</surname>
<given-names>R.</given-names>
</name>
<name>
<surname>Kumar</surname>
<given-names>S.</given-names>
</name>
<name>
<surname>Kim</surname>
<given-names>J. J.</given-names>
</name>
<name>
<surname>Chaurasia</surname>
<given-names>R.</given-names>
</name>
</person-group> (<year>2024</year>). <article-title>Dietary polyphenols as potential therapeutic agents in type 2 diabetes management: advances and opportunities</article-title>. <source>Adv. Nutr.</source> <volume>16</volume>, <fpage>100346</fpage>. <pub-id pub-id-type="doi">10.1016/j.advnut.2024.100346</pub-id>
<pub-id pub-id-type="pmid">39566886</pub-id>
</mixed-citation>
</ref>
<ref id="B9">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Binh</surname>
<given-names>P. Q.</given-names>
</name>
<name>
<surname>Thuan</surname>
<given-names>N. D.</given-names>
</name>
<name>
<surname>Hang</surname>
<given-names>V. V.</given-names>
</name>
<name>
<surname>Phuong</surname>
<given-names>P. T.</given-names>
</name>
<name>
<surname>Su</surname>
<given-names>P. Q.</given-names>
</name>
<name>
<surname>Phu</surname>
<given-names>D. V.</given-names>
</name>
<etal/>
</person-group> (<year>2021</year>). <article-title>Antidiabetic activity of Gomphogyne bonii gagnep. Extract against high-fat diet and alloxan-induced type 2 diabetes in mice</article-title>. <source>Evidence-based Complementary Alternative Medicine eCAM</source> <volume>2021</volume>, <fpage>8648209</fpage>. <pub-id pub-id-type="doi">10.1155/2021/8648209</pub-id>
<pub-id pub-id-type="pmid">34880923</pub-id>
</mixed-citation>
</ref>
<ref id="B10">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Bondar</surname>
<given-names>O. V.</given-names>
</name>
<name>
<surname>Rakhmatullina</surname>
<given-names>L. T.</given-names>
</name>
<name>
<surname>Shtyrlin</surname>
<given-names>Y. G.</given-names>
</name>
</person-group> (<year>2025</year>). <article-title>Effect of high-fat diet on the development of alloxan-induced diabetes in rats</article-title>. <source>Med. News North Cauc.</source> <volume>20</volume> (<issue>1</issue>). <pub-id pub-id-type="doi">10.14300/mnnc.2025.20008</pub-id>
</mixed-citation>
</ref>
<ref id="B11">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Cani</surname>
<given-names>P. D.</given-names>
</name>
<name>
<surname>de Vos</surname>
<given-names>W. M.</given-names>
</name>
</person-group> (<year>2017</year>). <article-title>Next-generation beneficial microbes: the case of Akkermansia muciniphila</article-title>. <source>Front. Microbiol.</source> <volume>8</volume>, <fpage>1765</fpage>. <pub-id pub-id-type="doi">10.3389/fmicb.2017.01765</pub-id>
<pub-id pub-id-type="pmid">29018410</pub-id>
</mixed-citation>
</ref>
<ref id="B12">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Chandrashekar</surname>
<given-names>R.</given-names>
</name>
<name>
<surname>Rai</surname>
<given-names>M.</given-names>
</name>
<name>
<surname>Kalal</surname>
<given-names>B. S.</given-names>
</name>
</person-group> (<year>2022</year>). <article-title>Acute and chronic toxicity studies on ethanolic leaf extracts of Clerodendrum viscosum and Leucas indica in Swiss albino mice</article-title>. <source>Int. J. Biochem. Mol. Biol.</source> <volume>13</volume> (<issue>4</issue>), <fpage>40</fpage>&#x2013;<lpage>48</lpage>. <comment>Available online at: <ext-link ext-link-type="uri" xlink:href="https://pmc.ncbi.nlm.nih.gov/articles/PMC9520248/">https://pmc.ncbi.nlm.nih.gov/articles/PMC9520248/</ext-link> (Accessed April 2, 2024).</comment>
<pub-id pub-id-type="pmid">36188728</pub-id>
</mixed-citation>
</ref>
<ref id="B13">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Chong</surname>
<given-names>S.</given-names>
</name>
<name>
<surname>Lin</surname>
<given-names>M.</given-names>
</name>
<name>
<surname>Chong</surname>
<given-names>D.</given-names>
</name>
<name>
<surname>Jensen</surname>
<given-names>S.</given-names>
</name>
<name>
<surname>Lau</surname>
<given-names>N. S.</given-names>
</name>
</person-group> (<year>2025</year>). <article-title>A systematic review on gut microbiota in type 2 diabetes mellitus</article-title>. <source>Front. Endocrinol.</source> <volume>15</volume>, <fpage>1486793</fpage>. <pub-id pub-id-type="doi">10.3389/fendo.2024.148679</pub-id>
<pub-id pub-id-type="pmid">39897957</pub-id>
</mixed-citation>
</ref>
<ref id="B14">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Crudele</surname>
<given-names>L.</given-names>
</name>
<name>
<surname>Gadaleta</surname>
<given-names>R. M.</given-names>
</name>
<name>
<surname>Cariello</surname>
<given-names>M.</given-names>
</name>
<name>
<surname>Moschetta</surname>
<given-names>A.</given-names>
</name>
</person-group> (<year>2023</year>). <article-title>Gut microbiota in the pathogenesis and therapeutic approaches of diabetes</article-title>. <source>EBioMedicine</source> <volume>97</volume>, <fpage>104821</fpage>. <pub-id pub-id-type="doi">10.1016/j.ebiom.2023.104821</pub-id>
<pub-id pub-id-type="pmid">37804567</pub-id>
</mixed-citation>
</ref>
<ref id="B15">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Cvrk</surname>
<given-names>R.</given-names>
</name>
<name>
<surname>Junuzovi&#x107;</surname>
<given-names>H.</given-names>
</name>
<name>
<surname>Smaji&#x107;-Be&#x107;i&#x107;</surname>
<given-names>A.</given-names>
</name>
<name>
<surname>Kusur</surname>
<given-names>A.</given-names>
</name>
<name>
<surname>Brcina</surname>
<given-names>T.</given-names>
</name>
</person-group> (<year>2022</year>). <article-title>Determination of crude fiber content and total sugars in correlation with the production process and storage time</article-title>. <source>Int. J. Res. Appl. Sci. Biotechnol.</source> <volume>9</volume> (<issue>03</issue>), <fpage>1</fpage>&#x2013;<lpage>6</lpage>. <pub-id pub-id-type="doi">10.31033/ijrasb.9.3.1</pub-id>
</mixed-citation>
</ref>
<ref id="B16">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>de la Cuesta-Zuluaga</surname>
<given-names>J.</given-names>
</name>
<name>
<surname>Mueller</surname>
<given-names>N. T.</given-names>
</name>
<name>
<surname>Corrales-Agudelo</surname>
<given-names>V.</given-names>
</name>
<name>
<surname>Vel&#xe1;squez-Mej&#xed;a</surname>
<given-names>E. P.</given-names>
</name>
<name>
<surname>Carmona</surname>
<given-names>J. A.</given-names>
</name>
<name>
<surname>Abad</surname>
<given-names>J. M.</given-names>
</name>
<etal/>
</person-group> (<year>2017</year>). <article-title>Metformin is associated with higher relative abundance of mucin-degrading Akkermansia muciniphila and several short-chain fatty acid-producing microbiota in the gut</article-title>. <source>Diabetes Care</source> <volume>40</volume> (<issue>1</issue>), <fpage>54</fpage>&#x2013;<lpage>62</lpage>. <pub-id pub-id-type="doi">10.2337/dc16-1324</pub-id>
<pub-id pub-id-type="pmid">27999002</pub-id>
</mixed-citation>
</ref>
<ref id="B17">
<mixed-citation publication-type="web">
<collab>Department of Science and Technology &#x2013; Provincial Science and Technology Office Region 2</collab> (<year>2024</year>). <article-title>DOST PSTO Batanes expands tubho tea</article-title>. <comment>Available online at: <ext-link ext-link-type="uri" xlink:href="https://region2.dost.gov.ph">https://region2.dost.gov.ph</ext-link> (Accessed August 5, 2024).</comment>
</mixed-citation>
</ref>
<ref id="B18">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Depommier</surname>
<given-names>C.</given-names>
</name>
<name>
<surname>Everard</surname>
<given-names>A.</given-names>
</name>
<name>
<surname>Druart</surname>
<given-names>C.</given-names>
</name>
<name>
<surname>Plovier</surname>
<given-names>H.</given-names>
</name>
<name>
<surname>Van Hul</surname>
<given-names>M.</given-names>
</name>
<name>
<surname>Vieira-Silva</surname>
<given-names>S.</given-names>
</name>
<etal/>
</person-group> (<year>2019</year>). <article-title>Supplementation with Akkermansia muciniphila in overweight and obese human volunteers: A proof-of-concept exploratory study</article-title>. <source>Nat. Medicine</source> <volume>25</volume> (<issue>7</issue>), <fpage>1096</fpage>&#x2013;<lpage>1103</lpage>. <pub-id pub-id-type="doi">10.1038/s41591-019-0495-2</pub-id>
<pub-id pub-id-type="pmid">31263284</pub-id>
</mixed-citation>
</ref>
<ref id="B19">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Dianti</surname>
<given-names>I.</given-names>
</name>
<name>
<surname>Hendri Aryadi</surname>
<given-names>I. P.</given-names>
</name>
<name>
<surname>Made</surname>
<given-names>I.</given-names>
</name>
</person-group> (<year>2022</year>). <article-title>Review of literature on Akkermansia muciniphila and its possible role in the etiopathogenesis and therapy of type 2</article-title>. <source>Diabetes Mellit.</source> <volume>37</volume> (<issue>1</issue>), <fpage>69</fpage>&#x2013;<lpage>74</lpage>. <pub-id pub-id-type="doi">10.15605/jafes.037.01.13</pub-id>
</mixed-citation>
</ref>
<ref id="B21">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Fliegerov&#xe1;</surname>
<given-names>K. O.</given-names>
</name>
<name>
<surname>Mahayri</surname>
<given-names>T. M.</given-names>
</name>
<name>
<surname>Sechovcov&#xe1;</surname>
<given-names>H.</given-names>
</name>
<name>
<surname>Mekadim</surname>
<given-names>C.</given-names>
</name>
<name>
<surname>Mr&#xe1;zek</surname>
<given-names>J.</given-names>
</name>
<name>
<surname>Jaro&#x161;&#xed;kov&#xe1;</surname>
<given-names>R.</given-names>
</name>
<etal/>
</person-group> (<year>2025</year>). <article-title>Diabetes and gut microbiome</article-title>. <source>Front. Microbiology</source> <volume>15</volume>, <fpage>1451054</fpage>. <pub-id pub-id-type="doi">10.3389/fmicb.2024.1451054</pub-id>
<pub-id pub-id-type="pmid">39839113</pub-id>
</mixed-citation>
</ref>
<ref id="B22">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Forslund</surname>
<given-names>K.</given-names>
</name>
<name>
<surname>Hildebrand</surname>
<given-names>F.</given-names>
</name>
<name>
<surname>Nielsen</surname>
<given-names>T.</given-names>
</name>
<name>
<surname>Falony</surname>
<given-names>G.</given-names>
</name>
<name>
<surname>Le Chatelier</surname>
<given-names>E.</given-names>
</name>
<name>
<surname>Sunagawa</surname>
<given-names>S.</given-names>
</name>
<etal/>
</person-group> (<year>2015</year>). <article-title>Disentangling type 2 diabetes and metformin treatment signatures in the human gut microbiota</article-title>. <source>Nature</source> <volume>528</volume> (<issue>7581</issue>), <fpage>262</fpage>&#x2013;<lpage>266</lpage>. <pub-id pub-id-type="doi">10.1038/nature15766</pub-id>
<pub-id pub-id-type="pmid">26633628</pub-id>
</mixed-citation>
</ref>
<ref id="B23">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Galicia-Garcia</surname>
<given-names>U.</given-names>
</name>
<name>
<surname>Benito-Vicente</surname>
<given-names>A.</given-names>
</name>
<name>
<surname>Jebari</surname>
<given-names>S.</given-names>
</name>
<name>
<surname>Larrea-Sebal</surname>
<given-names>A.</given-names>
</name>
<name>
<surname>Siddiqi</surname>
<given-names>H.</given-names>
</name>
<name>
<surname>Uribe</surname>
<given-names>K. B.</given-names>
</name>
<etal/>
</person-group> (<year>2020</year>). <article-title>Pathophysiology of type 2 diabetes mellitus</article-title>. <source>Int. Journal Molecular Sciences</source> <volume>21</volume> (<issue>17</issue>), <fpage>6275</fpage>. <pub-id pub-id-type="doi">10.3390/ijms21176275</pub-id>
<pub-id pub-id-type="pmid">32872570</pub-id>
</mixed-citation>
</ref>
<ref id="B24">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Gurung</surname>
<given-names>M.</given-names>
</name>
<name>
<surname>Li</surname>
<given-names>Z.</given-names>
</name>
<name>
<surname>You</surname>
<given-names>H.</given-names>
</name>
<name>
<surname>Rodrigues</surname>
<given-names>R.</given-names>
</name>
<name>
<surname>Jump</surname>
<given-names>D. B.</given-names>
</name>
<name>
<surname>Morgun</surname>
<given-names>A.</given-names>
</name>
<etal/>
</person-group> (<year>2020</year>). <article-title>Role of gut microbiota in type 2 diabetes pathophysiology</article-title>. <source>EBioMedicine</source> <volume>51</volume>, <fpage>102590</fpage>. <pub-id pub-id-type="doi">10.1016/j.ebiom.2019.11.051</pub-id>
<pub-id pub-id-type="pmid">31901868</pub-id>
</mixed-citation>
</ref>
<ref id="B25">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Hamel Darbandi</surname>
<given-names>M.</given-names>
</name>
<name>
<surname>Dalmacio</surname>
<given-names>L. M.</given-names>
</name>
<name>
<surname>Angeles</surname>
<given-names>M. J.</given-names>
</name>
</person-group> (<year>2026</year>). <article-title>Pharmacological effects and phytochemical profile of methanolic Odontosoria biflora (kaulf.) C.Chr. [Lindsaeaceae] extract in Caenorhabditis elegans models of Parkinson&#x2019;s disease</article-title>. <source>Front. Pharmacol.</source> <volume>16</volume>, <fpage>1662877</fpage>. <pub-id pub-id-type="doi">10.3389/fphar.2025.1662877</pub-id>
<pub-id pub-id-type="pmid">41646934</pub-id>
</mixed-citation>
</ref>
<ref id="B26">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Ighodaro</surname>
<given-names>O. M.</given-names>
</name>
<name>
<surname>Adeosun</surname>
<given-names>A. M.</given-names>
</name>
<name>
<surname>Akinloye</surname>
<given-names>O. A.</given-names>
</name>
</person-group> (<year>2017</year>). <article-title>Alloxan-induced diabetes, a common model for evaluating the glycemic-control potential of therapeutic compounds and plants extracts in experimental studies</article-title>. <source>Medicina</source> <volume>53</volume> (<issue>6</issue>), <fpage>365</fpage>&#x2013;<lpage>374</lpage>. <pub-id pub-id-type="doi">10.1016/j.medici.2018.02.001</pub-id>
<pub-id pub-id-type="pmid">29548636</pub-id>
</mixed-citation>
</ref>
<ref id="B48">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Jeong</surname>
<given-names>H. W.</given-names>
</name>
<name>
<surname>Kim</surname>
<given-names>J. K.</given-names>
</name>
<name>
<surname>Kim</surname>
<given-names>A. Y.</given-names>
</name>
<name>
<surname>Cho</surname>
<given-names>D.</given-names>
</name>
<name>
<surname>Lee</surname>
<given-names>J. H.</given-names>
</name>
<name>
<surname>Choi</surname>
<given-names>J. K.</given-names>
</name>
<etal/>
</person-group> (<year>2020</year>). <article-title>Green tea encourages growth of Akkermansia muciniphila</article-title>. <source>J. Med. Food</source> <volume>23</volume> (<issue>8</issue>), <fpage>841</fpage>&#x2013;<lpage>851</lpage>. <pub-id pub-id-type="doi">10.1089/jmf.2019.4662</pub-id>
<pub-id pub-id-type="pmid">32598202</pub-id>
</mixed-citation>
</ref>
<ref id="B27">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Johnson</surname>
<given-names>M. A.</given-names>
</name>
<name>
<surname>Shibila</surname>
<given-names>T.</given-names>
</name>
<name>
<surname>Amutha</surname>
<given-names>S.</given-names>
</name>
<name>
<surname>Menezes</surname>
<given-names>I. R.</given-names>
</name>
<name>
<surname>da Costa</surname>
<given-names>J. G.</given-names>
</name>
<name>
<surname>Sampaio</surname>
<given-names>N. F.</given-names>
</name>
<etal/>
</person-group> (<year>2020</year>). <article-title>Synthesis of silver nanoparticles using <italic>Odontosoria chinensis</italic> (L.) J. Sm. and evaluation of their biological potentials</article-title>. <source>Pharm. Basel, Switz.</source> <volume>13</volume> (<issue>4</issue>), <fpage>66</fpage>. <pub-id pub-id-type="doi">10.3390/ph13040066</pub-id>
</mixed-citation>
</ref>
<ref id="B28">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Liu</surname>
<given-names>E.</given-names>
</name>
<name>
<surname>Ji</surname>
<given-names>X.</given-names>
</name>
<name>
<surname>Zhou</surname>
<given-names>K.</given-names>
</name>
</person-group> (<year>2024</year>). <article-title>Akkermansia muciniphila for the prevention of type 2 diabetes and obesity: a meta-analysis of animal studies</article-title>. <source>Nutrients</source> <volume>16</volume> (<issue>20</issue>), <fpage>3440</fpage>. <pub-id pub-id-type="doi">10.3390/nu16203440</pub-id>
<pub-id pub-id-type="pmid">39458436</pub-id>
</mixed-citation>
</ref>
<ref id="B29">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Livak</surname>
<given-names>K. J.</given-names>
</name>
<name>
<surname>Schmittgen</surname>
<given-names>T. D.</given-names>
</name>
</person-group> (<year>2001</year>). <article-title>Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) method</article-title>. <source>Methods (San Diego, Calif.)</source> <volume>25</volume> (<issue>4</issue>), <fpage>402</fpage>&#x2013;<lpage>408</lpage>. <pub-id pub-id-type="doi">10.1006/meth.2001.1262</pub-id>
<pub-id pub-id-type="pmid">11846609</pub-id>
</mixed-citation>
</ref>
<ref id="B30">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Luo</surname>
<given-names>Y.</given-names>
</name>
<name>
<surname>Lan</surname>
<given-names>C.</given-names>
</name>
<name>
<surname>Xie</surname>
<given-names>K.</given-names>
</name>
<name>
<surname>Li</surname>
<given-names>H.</given-names>
</name>
<name>
<surname>Devillard</surname>
<given-names>E.</given-names>
</name>
<name>
<surname>He</surname>
<given-names>J.</given-names>
</name>
<etal/>
</person-group> (<year>2021</year>). <article-title>Active or autoclaved Akkermansia muciniphila relieves TNF-&#x3b1;-Induced inflammation in intestinal epithelial cells through distinct pathways</article-title>. <source>Front. Immunology</source> <volume>12</volume>, <fpage>788638</fpage>. <pub-id pub-id-type="doi">10.3389/fimmu.2021.788638</pub-id>
<pub-id pub-id-type="pmid">34975882</pub-id>
</mixed-citation>
</ref>
<ref id="B32">
<mixed-citation publication-type="web">
<collab>OECD Test No. 423</collab> (<year>2002</year>). <article-title>Acute oral toxicity - acute toxic class method</article-title>. <comment>Available online at: <ext-link ext-link-type="uri" xlink:href="https://www.oecd.org/en/publications/2002/02/test-no-423-acute-oral-toxicity-acute-toxic-class-method_g1gh294f.html">https://www.oecd.org/en/publications/2002/02/test-no-423-acute-oral-toxicity-acute-toxic-class-method_g1gh294f.html</ext-link> (Accessed March 10, 2024).</comment>
</mixed-citation>
</ref>
<ref id="B33">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Qi</surname>
<given-names>J. X.</given-names>
</name>
<name>
<surname>Zhou</surname>
<given-names>D.</given-names>
</name>
<name>
<surname>Jiang</surname>
<given-names>W. R.</given-names>
</name>
<name>
<surname>Chen</surname>
<given-names>G.</given-names>
</name>
<name>
<surname>Li</surname>
<given-names>W.</given-names>
</name>
<name>
<surname>Li</surname>
<given-names>N.</given-names>
</name>
</person-group> (<year>2021</year>). <article-title>Dihydrophenanthrenes from medicinal plants of orchidaceae: a review</article-title>. <source>Chin. Herbal Medicines</source> <volume>13</volume> (<issue>4</issue>), <fpage>480</fpage>&#x2013;<lpage>493</lpage>. <pub-id pub-id-type="doi">10.1016/j.chmed.2021.10.004</pub-id>
<pub-id pub-id-type="pmid">36119366</pub-id>
</mixed-citation>
</ref>
<ref id="B34">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Qin</surname>
<given-names>W.</given-names>
</name>
<name>
<surname>Luo</surname>
<given-names>H.</given-names>
</name>
<name>
<surname>Yang</surname>
<given-names>L.</given-names>
</name>
<name>
<surname>Hu</surname>
<given-names>D.</given-names>
</name>
<name>
<surname>Jiang</surname>
<given-names>S. P.</given-names>
</name>
<name>
<surname>Peng</surname>
<given-names>D. Y.</given-names>
</name>
<etal/>
</person-group> (<year>2022</year>). <article-title>Rubia cordifolia L. ameliorates DSS-induced ulcerative colitis in mice through dual inhibition of NLRP3 inflammasome and IL-6/JAK2/STAT3 pathways</article-title>. <source>Heliyon</source> <volume>8</volume> (<issue>8</issue>), <fpage>e10314</fpage>. <pub-id pub-id-type="doi">10.1016/j.heliyon.2022.e10314</pub-id>
<pub-id pub-id-type="pmid">36082330</pub-id>
</mixed-citation>
</ref>
<ref id="B49">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Rodrigues</surname>
<given-names>V. F.</given-names>
</name>
<name>
<surname>Elias-Oliveira</surname>
<given-names>J.</given-names>
</name>
<name>
<surname>Pereira</surname>
<given-names>&#x00CD;. S.</given-names>
</name>
<name>
<surname>Pereira</surname>
<given-names>J. A.</given-names>
</name>
<name>
<surname>Barbosa</surname>
<given-names>S. C.</given-names>
</name>
<name>
<surname>Machado</surname>
<given-names>M. S. G.</given-names>
</name>
<etal/>
</person-group> (<year>2022</year>). <article-title>Akkermansia muciniphila and gut immune system: a good friendship that attenuates inflammatory bowel disease, obesity, and diabetes</article-title>. <source>Front. Immunol.</source>, <fpage>13</fpage>. <pub-id pub-id-type="doi">10.3389/fimmu.2022.934695</pub-id>
<pub-id pub-id-type="pmid">35874661</pub-id>
</mixed-citation>
</ref>
<ref id="B35">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Rodr&#xed;guez-Daza</surname>
<given-names>M. C.</given-names>
</name>
<name>
<surname>de Vos</surname>
<given-names>W. M.</given-names>
</name>
</person-group> (<year>2022</year>). <article-title>Polyphenols as drivers of a homeostatic gut microecology and immuno-metabolic traits of akkermansia muciniphila: from mouse to man</article-title>. <source>Int. J. Mol. Sci.</source> <volume>24</volume> (<issue>1</issue>), <fpage>45</fpage>. <pub-id pub-id-type="doi">10.3390/ijms24010045</pub-id>
<pub-id pub-id-type="pmid">36613488</pub-id>
</mixed-citation>
</ref>
<ref id="B36">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Rohn</surname>
<given-names>S.</given-names>
</name>
<name>
<surname>Rawel</surname>
<given-names>H.</given-names>
</name>
<name>
<surname>Kroll</surname>
<given-names>J.</given-names>
</name>
</person-group> (<year>2002</year>). <article-title>Inhibitory effects of plant phenols on the activity of selected enzymes</article-title>. <source>J. Agric. Food Chem.</source> <volume>50</volume>, <fpage>3566</fpage>&#x2013;<lpage>3571</lpage>. <pub-id pub-id-type="doi">10.1021/jf011714b</pub-id>
<pub-id pub-id-type="pmid">12033830</pub-id>
</mixed-citation>
</ref>
<ref id="B37">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Saha</surname>
<given-names>U. S.</given-names>
</name>
<name>
<surname>Misra</surname>
<given-names>R.</given-names>
</name>
<name>
<surname>Tiwari</surname>
<given-names>D.</given-names>
</name>
<name>
<surname>Prasad</surname>
<given-names>K. N.</given-names>
</name>
</person-group> (<year>2016</year>). <article-title>A cost-effective anaerobic culture method and its comparison with a standard method</article-title>. <source>Indian Journal Medical Research</source> <volume>144</volume> (<issue>4</issue>), <fpage>611</fpage>&#x2013;<lpage>613</lpage>. <pub-id pub-id-type="doi">10.4103/0971-5916.200881</pub-id>
<pub-id pub-id-type="pmid">28256472</pub-id>
</mixed-citation>
</ref>
<ref id="B38">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Sahhaf Ebrahimi</surname>
<given-names>F.</given-names>
</name>
<name>
<surname>Homayouni Rad</surname>
<given-names>A.</given-names>
</name>
<name>
<surname>Mosen</surname>
<given-names>M.</given-names>
</name>
<name>
<surname>Abbasalizadeh</surname>
<given-names>F.</given-names>
</name>
<name>
<surname>Tabrizi</surname>
<given-names>A.</given-names>
</name>
<name>
<surname>Khalili</surname>
<given-names>L.</given-names>
</name>
</person-group> (<year>2019</year>). <article-title>Effect of <italic>L. acidophilus</italic> and <italic>B. lactis</italic> on blood glucose in women with gestational diabetes mellitus: A randomized placebo-controlled trial</article-title>. <source>Diabetology and Metabolic Syndrome</source> <volume>11</volume>, <fpage>75</fpage>. <pub-id pub-id-type="doi">10.1186/s13098-019-0471-5</pub-id>
<pub-id pub-id-type="pmid">31485272</pub-id>
</mixed-citation>
</ref>
<ref id="B39">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Sezgin</surname>
<given-names>E.</given-names>
</name>
<name>
<surname>Terlemez</surname>
<given-names>G.</given-names>
</name>
<name>
<surname>Bozkurt</surname>
<given-names>B.</given-names>
</name>
<name>
<surname>Bengi</surname>
<given-names>G.</given-names>
</name>
<name>
<surname>Akpinar</surname>
<given-names>H.</given-names>
</name>
<name>
<surname>B&#xfc;y&#xfc;ktorun</surname>
<given-names>&#x130;.</given-names>
</name>
</person-group> (<year>2022</year>). <article-title>Quantitative real-time PCR analysis of bacterial biomarkers enable fast and accurate monitoring in inflammatory bowel disease</article-title>. <source>PeerJ</source> <volume>10</volume>, <fpage>e14217</fpage>. <pub-id pub-id-type="doi">10.7717/peerj.14217</pub-id>
<pub-id pub-id-type="pmid">36275453</pub-id>
</mixed-citation>
</ref>
<ref id="B40">
<mixed-citation publication-type="web">
<collab>Slow Food Foundation for Biodiversity</collab> (<year>2018</year>). <article-title>Tubho - Ark of taste</article-title>. <comment>Available online at: <ext-link ext-link-type="uri" xlink:href="https://www.fondazioneslowfood.com/en/ark-of-taste-slow-food/tubho-2/">https://www.fondazioneslowfood.com/en/ark-of-taste-slow-food/tubho-2/</ext-link> (Accessed February 20, 2024).</comment>
</mixed-citation>
</ref>
<ref id="B41">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Soria</surname>
<given-names>M. L.</given-names>
</name>
<name>
<surname>Sy</surname>
<given-names>R. G.</given-names>
</name>
<name>
<surname>Vega</surname>
<given-names>B. S.</given-names>
</name>
<name>
<surname>Ty-Willing</surname>
<given-names>T.</given-names>
</name>
<name>
<surname>Abenir-Gallardo</surname>
<given-names>A.</given-names>
</name>
<name>
<surname>Velandria</surname>
<given-names>F.</given-names>
</name>
<etal/>
</person-group> (<year>2009</year>). <article-title>The incidence of type 2 diabetes mellitus in the Philippines: a 9-year cohort study</article-title>. <source>Diabetes Research Clinical Practice</source> <volume>86</volume> (<issue>2</issue>), <fpage>130</fpage>&#x2013;<lpage>133</lpage>. <pub-id pub-id-type="doi">10.1016/j.diabres.2009.07.014</pub-id>
<pub-id pub-id-type="pmid">19766344</pub-id>
</mixed-citation>
</ref>
<ref id="B42">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Tang</surname>
<given-names>J.</given-names>
</name>
<name>
<surname>Zhang</surname>
<given-names>Z.</given-names>
</name>
<name>
<surname>Li</surname>
<given-names>Y.</given-names>
</name>
<name>
<surname>Xu</surname>
<given-names>H.</given-names>
</name>
<name>
<surname>Wang</surname>
<given-names>C.</given-names>
</name>
<name>
<surname>Liu</surname>
<given-names>P.</given-names>
</name>
</person-group> (<year>2024</year>). <article-title>Lusianthridin ameliorates metabolic associated fatty liver disease by activating FXR signaling pathway</article-title>. <source>Eur. J. Pharmacol.</source> <volume>957</volume>, <fpage>175020</fpage>. <pub-id pub-id-type="doi">10.1016/j.ejphar.2023.175020</pub-id>
</mixed-citation>
</ref>
<ref id="B43">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Tomislav</surname>
<given-names>K.</given-names>
</name>
<name>
<surname>&#x106;avar</surname>
<given-names>I.</given-names>
</name>
<name>
<surname>Filip</surname>
<given-names>&#x10c;.</given-names>
</name>
</person-group> (<year>2011</year>). <article-title>Biological actions of drug solvents</article-title>. <source>Period. Biol.</source> <volume>113</volume> (<issue>3</issue>), <fpage>311</fpage>&#x2013;<lpage>320</lpage>.</mixed-citation>
</ref>
<ref id="B50">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Wang</surname>
<given-names>W.</given-names>
</name>
<name>
<surname>Dong</surname>
<given-names>H.</given-names>
</name>
<name>
<surname>Chang</surname>
<given-names>X.</given-names>
</name>
<name>
<surname>Chen</surname>
<given-names>Q.</given-names>
</name>
<name>
<surname>Wang</surname>
<given-names>L.</given-names>
</name>
<name>
<surname>Chen</surname>
<given-names>S.</given-names>
</name>
<etal/>
</person-group> (<year>2024</year>). <article-title>
<italic>Bifidobacterium lactis</italic> and <italic>Lactobacillus plantarum</italic> enhance immune function and antioxidant capacity in cats through modulation of the gut microbiota</article-title>. <source>Antioxidants</source> <volume>13</volume>(<issue>7</issue>), <fpage>764</fpage>. <pub-id pub-id-type="doi">10.3390/antiox13070764</pub-id>
<pub-id pub-id-type="pmid">39061833</pub-id>
</mixed-citation>
</ref>
<ref id="B45">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Wu</surname>
<given-names>H.</given-names>
</name>
<name>
<surname>Esteve</surname>
<given-names>E.</given-names>
</name>
<name>
<surname>Tremaroli</surname>
<given-names>V.</given-names>
</name>
<name>
<surname>Khan</surname>
<given-names>M. T.</given-names>
</name>
<name>
<surname>Caesar</surname>
<given-names>R.</given-names>
</name>
<name>
<surname>Manner&#xe5;s-Holm</surname>
<given-names>L.</given-names>
</name>
<etal/>
</person-group> (<year>2017</year>). <article-title>Metformin alters the gut microbiome of individuals with treatment-naive type 2 diabetes, contributing to the therapeutic effects of the drug</article-title>. <source>Nat. Med.</source> <volume>23</volume> (<issue>7</issue>), <fpage>850</fpage>&#x2013;<lpage>858</lpage>. <pub-id pub-id-type="doi">10.1038/nm.4345</pub-id>
<pub-id pub-id-type="pmid">28530702</pub-id>
</mixed-citation>
</ref>
<ref id="B46">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Xia</surname>
<given-names>Y.</given-names>
</name>
<name>
<surname>Zhang</surname>
<given-names>X.</given-names>
</name>
<name>
<surname>Jiang</surname>
<given-names>M.</given-names>
</name>
<name>
<surname>Zhang</surname>
<given-names>H.</given-names>
</name>
<name>
<surname>Wang</surname>
<given-names>Y.</given-names>
</name>
<name>
<surname>Zhang</surname>
<given-names>Y.</given-names>
</name>
<etal/>
</person-group> (<year>2021</year>). <article-title>
<italic>In vitro</italic> co-metabolism of epigallocatechin-3-gallate (EGCG) by the mucin-degrading bacterium Akkermansia muciniphila</article-title>. <source>PloS One</source> <volume>16</volume> (<issue>12</issue>), <fpage>e0260757</fpage>. <pub-id pub-id-type="doi">10.1371/journal.pone.0260757</pub-id>
<pub-id pub-id-type="pmid">34855864</pub-id>
</mixed-citation>
</ref>
<ref id="B47">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Xu</surname>
<given-names>Y.</given-names>
</name>
<name>
<surname>Chen</surname>
<given-names>G.</given-names>
</name>
<name>
<surname>Liu</surname>
<given-names>Y.</given-names>
</name>
<name>
<surname>Xu</surname>
<given-names>X.</given-names>
</name>
</person-group> (<year>2019</year>). <article-title>Bioactive compounds and gut microbiota: understanding their reciprocal interaction for health promotion</article-title>. <source>Trends Food Sci. and Technol.</source> <volume>91</volume>, <fpage>506</fpage>&#x2013;<lpage>516</lpage>. <pub-id pub-id-type="doi">10.1016/j.tifs.2019.07.020</pub-id>
</mixed-citation>
</ref>
</ref-list>
<fn-group>
<fn fn-type="custom" custom-type="edited-by">
<p>
<bold>Edited by:</bold> <ext-link ext-link-type="uri" xlink:href="https://loop.frontiersin.org/people/1673645/overview">Paulina Nied&#x17a;wiedzka-Rystwej</ext-link>, University of Szczecin, Poland</p>
</fn>
<fn fn-type="custom" custom-type="reviewed-by">
<p>
<bold>Reviewed by:</bold> <ext-link ext-link-type="uri" xlink:href="https://loop.frontiersin.org/people/281141/overview">Er-na Li</ext-link>, South China Agricultural University, China</p>
<p>
<ext-link ext-link-type="uri" xlink:href="https://loop.frontiersin.org/people/1263316/overview">Karolina Skonieczna-&#x17b;ydecka</ext-link>, Pomeranian Medical University, Poland</p>
</fn>
</fn-group>
<fn-group>
<fn id="fn1">
<label>1</label>
<p>
<ext-link ext-link-type="uri" xlink:href="http://prime.psc.riken.jp/compms/msdial/main.html">http://prime.psc.riken.jp/compms/msdial/main.html</ext-link>
</p>
</fn>
</fn-group>
</back>
</article>